%PDF-1.5 % 1 0 obj <>>> endobj 2 0 obj <> endobj 3 0 obj <>/ExtGState<>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream x=n7=J< 0 udkR|{n㧇/G_>|}j眅JTZ!^V_?\_/WZ+~ZTPYQ{:_>s|g>On뫟wݟ6H96}K|iQBDoD )Cں3ߡUW(ӵv t_p@{ )I% VW_,R+'?+kzy~aKD E̳vR^WRnXaG+zz7sȒNlYXiYkTFEXc  %hjľHzy5Á6 }Jn kSkYM%=8ZjYYXyAc/:0*pod'ޞv9T "ҹ}%hb([&X޽߃߫_d=Įqv{rQ@? 򸿑+ =+S t3$0)Zӕ"D VٵC5-d1dZF}xjz׹Z-FYN*]J-wSv-*f(lCǩ֊ӕՂ_eD6U%[O7e3d//rj\yVkl 6d#B?#&K_# \aM cjˬ*̇^Ooq\0JX׶72Y")VhI%i aE^Z0CGrHpM6RdVdZ(ɸ(%aZAQaۡ5@+MʈQ|R/&i/ "$'$D>bwÏ?W>pyr\a~vYBYL3)bOV= (͜ ~30CƐaKAFI98[r}Ub3v6W>1 tI{Fh;;&h"h-k@% `?c`]*Kɻ$udi,_[׭EB&/VDg>bBvW#k k [CȥF1NZ=UUt) :'w&c=lwl9YKt{*|O{#eiG5@o/AODx_RNWois e,'+OPMPG{CϱeDEPFk%)Y*dT/T1 ,;֥lHʵlM9O|-dy$uWG\+r?Q~'CPЀXR!kW-C})q>_Mװ׻?bшc⬟QJmt ^@GUAb$u Rkt,$*əzJ7yřjˇC:<۟cC_?X>|wr@[r= 9R9 . 1Kj KR%z,B`rPkA`Kҗ塡72Jڿ({axe_ F@d ֡jOʁ/D(i6KYj*b3"wpo?Ҝ`:=r=`0yJ;#N ңZ| ثhMBvN-JU97U A0R#-*Pĵ^y夢k 'vl 90C]5{vDlO7@ew{,fR$VƇ9QE')bk<'fTCcdQY؉#zc}>bh,p@@#Bw-$#o&)60Nϐ ݌kw[ Im"c,cOu 4cC1Dɚ'f,Ls 9:D~ YA \L@sЋ0%$reAW3ST,r)\D kNqõ@;&rR3@-(D7Aĉn 4z _B`pdR|S Kɔ 'O|Yh9AI([q1$-bg<6+&i8bZ^YDKKo X;GNVBR8, *T>)VM.Y"PA%4@^l)ZMQj 8%T M%pnnK u``bЅr<~ko"h>ѹQ˛Þ1oPp&][ޞz1g z{P] L$tVYi]#ȹ-#"lTOs3QfTdm|x@hH` VNw1[~1_ [t7ɑH7ZF|o F/+J4*S0T>Cc F-:SsD*DadHS;VSd4J0ܓO,; \̥װlM0CBrj Q[FXel9n<yNhyU~B:unPr} #Yݔy!ֱsvPy-N9MqD/e/9|J:KINS餔OlNN%{?ƅZPa03&4$ Jth8i8/ހ̵Cãas&8!V`}^G"=U-E)\"<23l`K!I=4C1Ɉ7tr?vc۩|EcU$1T4;*X @OV֛׀]lFgCTph*4ԦCvx VIMiF5]QMp)`SlĊ1N5i%\T mQBM(L݉Ib.,,vF: b ErY|JB:nX G 1sf)\&Z=[b0t-;myA}@Kکt6ݲ*J鸺9sy>w]B/&jHpa'sttwT ]2I6aymc#F7Jų9 PBJo[ziD7OtBai}J(w X0 HqZo {YW.㠥G^cOj<證qjP qq0wY4gxs y#{ң<~>WX#t@/8{xipO*>|^yk*SIЕ?S|8,hGW>ZZT1J[NMrñm(9`%xԔ+ݡI' SB !Q Ғ3(AUč6UTs1h>Bi!_v K(.=[w5H#X*s[^N> g%N|z m%a冼 (%2l%bk^2x"Lqpa&V4р# Y^{e$@Z.AʋF3gA~3o[Ii;ZB|vO fœw^&xc3  lq! %9,t[F M‚KpVqH;2\ΞP:[W"R>ߧ/N3,m裂7pCA9@s!(aQ; 0W(Nη*oljyI?_`Ȕ e7k-[VkS yhSJ尷" ІÕ35m endstream endobj 5 0 obj <> endobj 6 0 obj <> endobj 7 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj [ 12 0 R] endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <> endobj 17 0 obj <> endobj 18 0 obj <> endobj 19 0 obj <> stream JFIFZExifMM*JQQ!Q!C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(((((((((((((((((((((r#cFf8QjAyd<#be%̚ S-\6$CebzIqu7\ĄUq1O٥#73G!NJ"19jݷe ?=P)+IHt-mZN= ̭?ݠ\o2o9b9C᭨YM纨k)6CGo?SE)%DJL ~ iwTٺ,d9Hi@!0o=pUZ]BVb6"MݪԟƋSazAAr$7Sʹ7~dTm'Нȹ<p3'IEZ*kY%BÐ{ECY5mSEPEPEPEPEPEPEPEPZ:[ܺ2m|}9gaVk/+ 3Oz%R}1aǟ9wTFNmXpŶP(sd2O~GQ>eT50Ђ>nOpq8қm(i` OAQ*%=:f`$w#harۗKyEv*H$p˴gĐ:UVK 02+dבNTF]4a<, X|~5"Ԫ]Nv/*2y8){Q,[7tI^T.AlCk.xp5n-fv6=¨=T9p@^+ϢͿueޠ2 GvdޢWOsB+20&F  $+7;Gt8VTL;@M)$|e$nFelq?jBV9*Fxx* i"\uX9t&Ԟ6#%ͬr R:0u. ܆(,(((((+fN0ԫM _Dze첈·ɜc̷Wp\c^#8up fRnO s42eULHU?2_2ijMasn,ܹ-e6)>1u|n8aTZA8Ry~ƺsA- 23цq{"SZi|.#**8ڢbKG)8EgedlFY`A^q=I8\ed5.%}RV)5`FF;;| zO 9BĽ{ވf{Y2>쑸<~[[neb<) $k: ?YI_0?4rt8LqFg%L(e*z{Z,[r@mP~F8 ) I8;r`@t *]|,HYPapcj܎GC,\9Q{խ/Ki)dBb# (緹]rđ12:cas J :oZu:ϖѧS ҪF2%_c_+RLQI__Yml"mFgCgf]YXQr pim.%e dqVLk[tGTI9!~Oej>peE\)!PG`srƙګ()L ٿvMgE+C*ȇ>q] Qd,g {s|}ڸ{˕5RO [?U=pFGb3棬MB((( 6}*>f `v8鞟l\[۝>T|>c`lm#QjCEʠ㎹#٫e⟡Ϩ#@:gVɂ0.ImJʱc1t&)&" `_=F8+ҡt[[$Dx #~מ=J|ms1 ]Bw| N@gEk[ \' G*\gx楼 p%bʓG< dEv=5]gZvZ+:oxT%X, Ow lvϳ=<)Czڤ}c7B_t'ZC ?,|-ZfZ /rv?|)$1Ic ixJ^PC†Gm:gpך稧(#$N񵔲3T7{o|v ^cuk=֗Q479X۪no xUsgDS1 4M+Vk6 xSiE2K! 7c98=v&ʢsOj G.$~7omGS +O]' |s?Z 1Z=OV2Īlp;S[2"ԑN[z烎lՃ$m 21V"&=; ;kqepIjE8޹8 84ܤ/.̍rFn ]"M:Fq,{rIo;O*@gi0BX(8mv=MIGp)Y[NF~Փ]#ZdB$hX}9#ǜInEVfEPEPEoOG2a3'ꁅbI^DE 8k| p: uD-lrK  '޵o48-LyKtęx"!-ܠ@߁`jwIfѧu $EPān^{nؗk4vy= XKݿs(/|]ǥ2FJ%V$ߒֻk'ᯂT:ĩ7QeS|$گLcxcZOn?cV.Fтgin->ɓYk}yd .Ġo62nq=i,`k_ufRLpQp2EsmYfHcɮjhi/7c*o\ٛ_ۺG?3`Ϲ\׈/-*FiFc'i`όnutD3q,M c#t5S]֩9H>r1j򱵩cwd{e6#ҫT820;A#?\.iF?_k}>åMkqky3y> eAx@qgr.UF~&իJZxPJX;[[lЊ(l.FfF})u]tG*HR-%BuIe6ya8mԗ\"Gu,qѫ +WNb$v>& A"\ 0j&:MQYQ@X.uX$eDlpH^i\#O5Ɯԇ5OHc,}.P=HU|s+ 7vfY#}\6ϧkW3=i)Aa2vp2;{UM'S^P,?UcT{O*.a\ (s9?jH97)L%l'K6 aS* I 0a3QEDM|p~5|k?kŝ[\D7Wxуx :}Cj?f=cℏmjmG^kkRy"`QOz_xvdHD,F!a^UuI$6Y`{^~.4eΕҕkpr ]>Kߩ6tl`< 큟W|Yw69a9UG7r#"6aS5]!~̬UWSsЊBsk1IY}Uz\E J|iw% F?k?_B"URddzùsavc"3NI ?dx]o*?י?3袊())>(8Zp̰Oc?suLaBW Hx8be2dVU#YKK72w ?V>$i648eK[hLv`.x*X#>giK4F(:ZI-H{@n?l$;ۢI'&ʎEݲY? QZdm<+]v8ʌ{s5M⪭6QEY|Sy'pwzck~ (>j ˟Qa4Q=0ֱ&o?(֏1ڲ)vpۗ<*יh#ԯu{i!!'W{WgF+?@jXJԫ('.W3Seգ{\ֵK]qllJ`%N+~o3n*ƕL~HR?3U+#Ul~ejqSN)IwmC4T&*n)+{g_FTA1 g{_fu(tYpKPw*Ug<{x\ R(HB+)G pkM C࿊l,\,J]9lN7(y9֭uAq 4r;+}A85F"#N/AEU88ڲ$Cey=!%tc?45,&6ƌoVېt~5lbwl/0 2 Μ:MD4hݤnzQjj"15V1:Gq͜yӊHCWkf]دl.2{=s)ilMNq5ϴN\ [ v'VuavO$# 1;(Z2I7uR3OYZ&6DeGҩOT+#P((wNFvd!S's+?T#Lr(tbyqqޥѮ^;>Րn0 ?MԡV;2Iq돕@c[?z -&эEV&LKkTJN܆' ,qWX:|$rJ~I(O3xc+QFW]_pX/%~6y|ֵkZsgȈ.7W5xzݎwqm45`QzsVYs1}-a( ?EuTRs˩dc-Kc]]{iɎx6=pEv){U޴X!V⫈f.,jpҴ=-EcB@5w \o5:*YquMBqs,p7j6\mEaʦ8<`<\evzʅVd`H`r<[oB@ iqsa#ye8 8Yt-驴,Hl2I8)`I$ORksRs T`#w61GZU{#:}XQEQEQEhIᑃ)yh|biᲹ9\ji*[$d29{ִ޼/N7;Odv<棭}B٤wGI2''wნg8iDϵpI}x=:8إ%k*A#knym C/qc 3z+OlPm` uvJQ,sTg0r:[]+[G!+B.-zRXwg;veZڣ8IE?#G"Ȳ 6l#y:wcK%Y`av`t-*z;g5~gtN$*A۱=ЃӚ4kSR+yŪ*)ɨYsr+sOChm+{)?Sf7O%p7aGs׊V= TeBy"<VwFzgNXm80};ug#G6yI-O Bj8n9WtDgزHB < :Z’/. PqrM])V iMݼ/GSɩ!M.Gps5Af|'wS^&ko%D] (^9<n.RЎKGn]KO\tŔA䳝98S3회uyzJM.C08\ڴ6Fςdw:p@C103 dg8ۓ*-ɺ.>v&$o`1Laێ6p{ ̢‡QYQ@Q@Q@Q@Oktn\<2TSMt&VgH)!<ϚgwxqFCF5o$9R!AӧOLQ[^Mj[oO ݽ7OB)<OS-a]٦8 !@XpEI@`0s4 7df]rH\㜅Cud\i3'ӧC@S֨4[|KR~w`*ܦ,jpv acR'if , Tym?/?t>meu]I433 IfsSVr٢{t˸Ā {=v^H-W,.XzU'623Ɯ!ZdˤƟedTg2[Mn 1YX6d{pi *N2rt/?=;jx%wh^N}Xүiqs$6&$;BG^N Cm[%*\\`89=;v'] i%O1@V7{ו>-6[\Hl"3Lzn|WXyl8#FM7W3Ay`Y0;s\iH\XB* Ǐ.W ۠/5UGup̼@x湸nnBkfu(`}G'6^Ijnj h~/}ːAdx¶`̱1CgBqZN,ɓ,gaw{iH .` A ?qtub{1&v@|zgF̀0VIӺqկuO*5sM|b)M%h`ۼ(B((((((Ѻ1WSe8 mkm](\csZHY@XoN8\ pxZ$lrQZ*jf鯳>hKX`ȡAq'[`o7TA8ڧq`M-,`,+׆z>irWY@Yn*C|ߐVy:VqpdkfmOCuZ^H֖ѕ|#wןַ igKq4S(f?I \nV,B=ogqsnsWݲjW''{qxQ#2(@1۰J`-{㔦9TyVGhG/ WiVNWH3+#ңL9nԯlOe &2{#P##W~C!Q#u>~ȭs%KQWR%ep:Y O9 ϛZmXtǧ`Os5fY rH\P徆ڬ'ۘvrOcNFx5=ķ.W@EEg)(QRPQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE endstream endobj 20 0 obj <> stream x]TE733IY," f==rfAjFu߷ y툥h҆%5rDbBVߏQaj4 wwt[ :{/\c}xFbadz61&^sy>-4vɳ?ϗ zx&" Z_GmSZb ;QZ)]f/*`Gl;uc)O$&#+{RhQ"XaZ$}-{Hy39QϹIee(mx1K} 6+׽'xdܣҟ΢/@/vyw7 y0@J3@)ai',F;nVxYh f0naw!Z00o:Z'HjO SÉ`,Q78 =ёMrQ  )/~HQ@{BV\dl ot_J#Yi%@#&e)DIR4ʕ"SW2j j0.'@z#7+\E? BR$- >q^l8א=W]x6na+k?Ec( ЌHNR VTH-x)&%;ļ2T2M|f,iJёA&6~_MEB{15^܄^T 0 ͱTt"e]1LQoE|IYYxRN8zGROf e̖GWgx_&XgzQv$ & (kϮ=8^}m?\m t4z7?0xz%>?Bb?=WC+N"'\%*SPߧ9w@c!Mg?7 [plaȦ !C߅:(y=fBRSWp>qCVּ'wuPOC}Œ([Ow8$ɾw+"?A A{/XH)Bj'\Uп$~!ؘԠTUU e*d,vx;!Wn:Vx Xl#UMm?Ư7ݡZrIJBO@}ū4t#^Zs/ܿ$w%!vwBV Z~M;qЯuJ3ZeŹNtŦxr\0+0;{B?yY9 و +Amy'bo[*Vk'->P-8(5P:;1D Rz$1lsvgtavDžViw$fdu>+5)ԚIDbqE2U=_+աVvsbInT_ɦ._|W.>;??=Y}@q5HC{a1˚ ϓ KL!>s,Ov SƳ) (y6g?wC~Z LÜiUqGwQrtx: (Ym9&Q*_k-ϰ2N}~s6Eiz.-J<)lgcOll8Β<çiУ;EWփtKE>%頇LRӸ`}Gw$%ˇq91=H)݂~]cC,^mX}6]i|?ԋ4M9d8R\bT}n)<}ܸ2JO~N#I#ŢZL($1NLgbXii$nPae|Nd~N5'B|tO"J? a=zt$C)ލ8Kw6\PR@eGx Þ9ōd)]7jE &d HG6qfV17.ljn3 k9u5k t8L^WA b0+bO%h l.O}P? '6YBYHgk-ԿzW/ EB6٤k @ܥw;a$lk?G|͏&s |,֑`<FI5a߈W^pYwk HoP\TzOQof~p4+u"nQ/zEiX`(7%\زuWƳ{죞]ŦݒtȺM]׊Vyo1Jw^HIOyon IRFyV?Tx xv4Vƿt6tX=V^vmo^׶Z_Hul1(H36AM I`8j`it{|V yTָCc'$yx \Q_vUPa,ԉ_ݴnjg57YPf ]P[Ola&2 Iʜk?i+;=򙾂W,jT] xWvӎc]K<1,e fӡ ECOwWS-LI5wn!w.)g,"j؏#@=mJ:]٭ZZKw>ެt?*" t^R7^L#^R~JJByؙywਿTg J{qvӭkz~ o1c`8]z -[A/Wu%;+ީcoN4voJ4 Bvӭ+2lPNHi7b~UqP;5$jcMÍس0p6oy>~&[E,iZTexxPXO=vR*^]WG$#Z 5.a8] :45"GY[y@,3^&o ?NQ|}-t`;>zvU"s\ :D'<ۙ4js57؇EB'ԗ-_ℯՋsH8m?O2yVgTQB#BJ.o3:~cw(Wb0y L“/7b7,=wqqI'0. vߑy:eS abM[uQUGC5nӆKFX$X4s?tɲvFh7 S@w^WP MV T kZ>㢪ae]FJƂ*9`QB>3Űh'b,H>?A9j Ėw c݄ 7n jZ]˞;l‹qeF݄ zR5]|VHK0-= \&!s +BeL&f`pbEzn-͝&De)Ƌmc5GrF"XrЈح7(qMh޼'6hZci$i2-q".". E2janswP8A#-NH[lؕAQ7Vg$R`Opwt1h'bRҥQe؎7'8gM\Ϩvͻ3 &i?qP1iKL6ި[wc>[1.MDR7P~oԻyn&Ћ(78e~摋ENv/f F[גp:[LQK:a/??!7ɘ$lf1ݎSb1n is'EbF gPȧS$l 3z,E4k$Xbr8jq**9g% x1po`'$ޡ)Y'v4 GP]4'̾RLm0!< EY)ĸfpAY  JExTLGUmr49đPmV('+c ⴞ!AhRᏡ``'HS#dG*q)(5mw&Ie·1~ B}Ҙ?^ZV!NX WӋ^$Y8 jĚ`(}, "pbaf&tǰu,B*Ep _ΡCS܄L=s7ָI{ā;C&"VޙJި}*e)_˱xB}U6L<"_@{rPvy5m *A>K<%Mrj=&D~8진i}_4pW `?sUP,6lB*uux?G40 'r"*([,"oK HL%UY۴(¼SMIѝq䥍y+C9d'PD5hZL]uSOтH=R:dKugst/?,_* "<7|7o1$s| pZl ՊY\%̒=7v3G¤g d|Yj+8xla9O.} N՜I>xtR_TzT]bxճ+ʎƃd9Þ?̌ ;ڱJ} ~~ Z'b`V6FhaZ{ ӓ_ Vr<7}k:9ˋpFX 60g~#mз?Вմ5XI|J0 ۰PzM2#{L×@~r} F9A= :ؿ.s쮺+Rr>jA߽Eɿu&,_ z6N& *Z=0EWspAMqWۉlg(!?9Q(cJ4喽#F䝛*,dP a'PvkKr/y#GY 8:nLJ_jM~5/8,A)#[s,2,MpsUSTZ6o7Gi*QQC|7n #s'+ȝZfčH찝XKz>DK ErpgZ 8ܒ!2omE8,Eϙv0.,R~k#)*p'H¼Oi֪qJryU&o5Dč־]k-+*SưեtFw~T!QǥXc]>krwc uy29j#C UTG) v?f#J}8Hj9~~b?,`dtբU(:8"<;zi: TJB~R}ܕQ{:G|]/䢼8j W0G[5J@I^>=gW]3W.$7͛%xp=+ ")+պBC iF<g,Kjǰ;n1V v^9\ ~v2ʩ=0e~:O Yk 60= /@asH͖ߐʡ$|S.E'%@ 6Rپy:(zE{taq5|ii%lM A~+@ax cMnКJh_`O!VM5r.G\(FAlv% ^]6k^%x>'\U1m~Ayz&,gte+ Rk2aNz,ZcG{mDOP1c2PykP#шg^tKp >To̐(Bk`ydO4+pNb9떏8*BD4g/nK ҭȻcQ?`dmM0?# $BÃK?<࡞4[<.@yQxˇ p ¬LSTO@DւR!|]ICR !L eYtU)+­[JNHir3i8[⸫gXȳIJK@YÓ(q<,p4 lxd+KhG5MuW%5㝳X[9:lj3߸H[ENOg)Ffu@n0È,^+Iw?ti&.@Vڡx+vj,WZ~51~11W;z s6C@2lԐcPۍ)A=5e4Qo9ʲsb pa(3vȢ/{9d.{|![3n%_Up/okr+ypm~{دWy? c13n#gƺ?>23r $IӚo> endobj 22 0 obj <> endobj 23 0 obj <> endobj 24 0 obj [ 25 0 R] endobj 25 0 obj <> endobj 26 0 obj <> endobj 27 0 obj <> endobj 28 0 obj <> endobj 29 0 obj <> endobj 30 0 obj <> endobj 31 0 obj [ 32 0 R] endobj 32 0 obj <> endobj 33 0 obj <> endobj 34 0 obj <> endobj 35 0 obj <> endobj 36 0 obj [ 37 0 R] endobj 37 0 obj <> endobj 38 0 obj <> endobj 39 0 obj <> endobj 40 0 obj <> endobj 41 0 obj <> endobj 42 0 obj <> endobj 43 0 obj <> endobj 44 0 obj <> endobj 45 0 obj <> endobj 46 0 obj <> endobj 47 0 obj <> endobj 48 0 obj <> endobj 49 0 obj [ 50 0 R] endobj 50 0 obj <> endobj 51 0 obj <> endobj 52 0 obj <> endobj 53 0 obj <> stream JFIFC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222S)" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?( ( ( ( ( ( ( ( ( ( (4Ukk(LS$1Vv*Hw)A2(QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQHh5֚E˲4SPbnnF>A^-k 7-Sz%]ߡcY~"!1!=ϩ^މ"[7A\߰m^PvW{^mO,/,}2u `y4U܏{{>_9Z qL5IT%f-QYQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@SK`l=glP&BQsYGQZڄ }\8=+<C݉]IQPzYHOJrzU $i_'4rsW__?>tl-V=Oߌ xnMU@ٴ$G}G ~ +{ 8mbXv( _v;_|ؒc$ 0j((aEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPE6I9kbrEZWd]7H7I# #=T3ci|fyx&ÐU]剳qiHwO'ߑO+> zf{oʟt @9ZZ餳Y"V^Al<ǧlܶ*lxQ7sNR/hzц">'M)t]S[Xb2#__ƃM/m[%GVaR,ȄRY#F1ی[F4rɨ,j1Rvĝ35nfq.lYd5u=z(ֵ" ZɻQ3u?h"ZCG֘PQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQId ֵmZi5B(Ȍg;rDڦN*j 1c^ө< ZKIwoa݁W¤y/4*p+4<XOQX:kl"\ڲQTTqƜ:zL6V5 /Q{ץ}Aկ.fC(670@6WIs4%iO3m楨_ihdmnY[0:̺g!Ie$'݉I?t*1BR-θAAY M|ȧS$gKwv ?䶸g_rk{5ZԼX0Wi9q^/zևzҳ1g d%0'iZ_mQc%Wݷ'8sC:_a>횭:( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (=(=+Y %oD"0H] hֵ/RŞGWoEAeBlf)q|gȔz;g=JT6G[d>vua8xtu)m,[xim6\y9Ǯjk#\+_*nxˑ,gv]zkh4r˕%]=..`ӠcNbJ2dIgn^Ik`,w3LEZf+Lӯ@9ni Y(b&$ 66bzԺ&2jwi _zS)Vi VchKjSvO$L +w;#d-QHg{#ux/pxPA=@f\]IHֶOp?U=[==H Z"J.rO=O4&F й$DwNy$5j)#cH!+He,w̓+1'qQ %;BYZ%OVQP˟Zubr.N/ͯ6 EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPE uOlO>|0ݘQM7YMc'(cRIhw5knoWWd௔8MQ`~9ɭ#­K{' Iw\I˜5Nl"|XRkPP U?=x7[LTqƗ7!0rsTɆI.!mB#'|d7kɹb@=:UC8uYo@L=N*e'Mm]'JnPq/'ҌJ+v**Z(1H-ڬEVhHN G[AJseҫ`_(bHX#@UF;hTpRΒf3>cOեYϬa*>@#5G u >t< w$17X]x{|8r1ap>H#c|$Yj_?JrC րX7LӫЎ+c:?߻7JuQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@R fj&;auc}w?jn&k#pPF2@w=|K^|vPI (s+vcRoBGWWrc1694~$OOO(J߁g5Q jMoy>>te(Pe~\b;r}YhvZV;ex,c_*9nyc[%G+(ђ#5fGO2tG;<=p~S]i54SsjS̑kod#ÒzɬvO^gi+Wl;nxEiA;j3j aqIzQ&65MA[iobBq=Iɶ(!hE c'Ҽs~=報ۿJ)?շҾi^Us\x0=gU9.҇] Ǫ tv#&#lj#.ލ|Q_:Vg޼_uFzxe~!1]fW3k9.׍ת|)muWUe;ΰ8z8W:pILCX`27ݯx3LXk]Hq @ SxË;DuJnXة0kmxRw:\D sX03?]Q{x/-[MoMGmͧDs+n~Q޹m.=Ip?6}%2+}jAҼ`ϧٿa^:WcU^(0((((((((((((((((((((J3Y|J%;a>.ǧBFyNaO#zz\Őa|ךݔwsN$r"y A@n3U:]Tgʇ,SPUq(/t*שld N:޳nvzeXs{svim4"S>YrXS?}:촳ی $ii{"; 9>u5ē) ceglWsqei8a@Y1~OLս'GtmSQԦ]݅;"SԟTi.eiz\Zj rSԟʶ ZZŻ(PQEk'8OM|ֽҼzO~huvl z‘M+ʫվo2'A=)iJCZfY/R3T *fL^QEyҝ]׷+J_c'w½dt˿{/-Q]ǐQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE%f:Ůff` F]ڤԵ(to1;1H27`szghk2fp$2~HpٍZ+GrmI1nʘq DG$fחdi~]7/4[<ݖ#88*.G1^!Jn-pH@^@榋IN!E`$;2Z](;mB;;&.w!RĹH9 zpw5_7OwGmq+m[{u25^J# gTou?݇ {fypct*apږ&@OzlpM)[o[G5{,&@!\2z]6θAAY ER,((=p*{W7SHWzOW(_8~ F4{V_OoeZ2?==+>rQU#TT*׊OUZ}oWcv>%DQEyҝ±?*Ҽ_/uw?=?g+(((((((((((((((((((ZkI4iUɫ2ʱF]*$zZMZsJ b}rߢj9({QB8Ջ|S-Ќ 6&ck#a'98=CS BHmc$s_s7*}QX ֑yomic;e;wJGN1l1ە{m,74,ͻ |FppF_a@nɻ oniXƄz3үjzVJi.$ ` ^:jW9IHL2ˌE'I':v_nOz6j"XTUQE ( ( ()gUk!־-?鯝{םOc(*C(+> H=k?<.!s=)iC_F|o9N_f[gĜV9ɿ3U/_=}M(;+~_d׫v˿y?-Q]ǐQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEs:tG5EG0;~%-mRNϙ=ּs_BJ6N;Fr˫ErbK09H)'o#«{:-_/LկRԣ1r)<ǎ3kpAͧD[^(-\dv<=kS5CK!14DG}J4L SI¸;?{CѣԭS Σh?'F@E.GuF *Z)2=E-dPEQEQEt-@ɶɯAYI!_3<r UA?ʦRhEl l? O0M'_wQx9Ozjz!H Gs?֦E =|5Xl!QEyўQ>5ꃥy˜R#d@~'ץl:?;Τ!h<((((((((њ((((((((((?xAn[Kf"cASǭexG _5[ ۳x[-ƕhX[%FB v.cC1M }Hjw>nվet[5}Klc8\= qHd1]=c41᫽\YJhwj ⻨#8ڨP29?è݋C+@~_'^J?IҞ i;^ڥzo!Ƴwg_q^:W`')R>'9 X jA|{|_&dԑ?RG_AW|Tbjɺ{1@R'5"89&yb6 KTl-^W+pLU)-¤i-IvT!OGEdNRVghmVE3DSGQVGSZ*ӕrJ&h8Q¤<6 JJVdv3=|X\JxÍRO[+(W'Z3?/ V;ZK6lK4_aq*g$p)$3_?֟c?V%)(WS)iVc;AuY2p>9~#V)gUVs$NWko+EuLlHT(7P/?H<EJW^լ??wN̂f1~21փ8_q5 Tv/A!^,Kj i/N#ѧoJT_h p5#.PZj S0U=jK=|El_tV+wfd?|ZM?eO4˹~:ry /?XxQppPA—60qQ,d"yJIO+<[($ڦ_zjK)'k3p!#ީk R$yTy2-z}w+Ybٳv"qRўI^/i[^Ab0UZ_:mh-5('fΨx+'^FAR㮝n~G,o(J^uҢ?IV|s/V FM]\1g.XLke80stGsEWYQ@"^[]2$P1KH'zWeLEEQyI6;DH#G4 5GEa2s@_[ +ЪRy(ԕ90YKf$N#Sq_%s+Bmx;/ +r+\p˴ƻpև4Ycs8JixῇH jo+_;k쪽a5+?Zx?ueUd+9<+E𶗠YB^IBGfX6b)ȧ]'|q&Dϧ1&>%e~b7 H:&Eu! ן&HE˖9& dňƪpL,ZW'e}29j31IhY+Ʃ֋\V~f'VO]"}@!!<eMVY4WK|G;?BMoi .]{$'֐W&5s|%w458[ N;[HY\os++|9,2aOsF@bT-5^>՟%f>HiJ?&i^^mCús2ɮ+ rFܕ#UtGiUM9m)lքT+6 X'ğ OB첼e tڔkzu߇{U8m~}Ed.`\d#r=UYv5hZj;SeEf8UeP?vU^<|$|1K^Ag'OTt$LSޤ?؏'Ơ {35C j\۷VSV:xÏ#?W-G1f7\|r1]_ sNtvJ=akJ3𠢱NOhEwN'޲چ+r=k9<૚PQӕuUk վ*9.sVQpvg|%̥]}| MF9+/5/Qeg턜vySƙv_ЮJ=<; J|1ߤBD[zWVZc)-fp;(₊(EXvY\#7O??´?kO6_*"lE#cЭ4pyU% ְjNUn9+7~eԽW$U f9l:Tyh^ger8֤J7?ƾ#x/i;?2yrC; }J;Y2?[ mt+{{nY#U8$`a+ϥ'J|<&,dNO>z]jh75kjK1YJNF!)ARQEQE&E-FzQR@ F-)0)h/hE9Jm\WkFz_FWj27i({\?}ykT?󯣓Z+~!ħ`Rm+ױ~?VA[_]/o?\\EuG6(INz“8|j.}.j?_4f?Cy:k"k[HO ֶޮ =QZ!?Vjki!\tOO 3;oaMc5|B:AwRϝ(-zCU-Ck?M^T&}5?aXff$ٷ=%]k4l1X k% [IL00\Ug6b?gMGGT#;jjA##p?]tchf.JU$9>3GG: 𥀇RRGC/⹞D3zrAoGƕ5<nC[`RA EKbۋQpۄ' n.j~gy\0t IҎW1(Rv@3]a`>?cR=-BZ'郩{hȦdRGFidP挚uѻހE7wSw 7 uњu܊7 unFcѽox;>3ǣ7^K}k?}^uk袼ؖB?:=>+?/s)d|$_ƽϛ Q-sp]'.GAړ4 ZG|*?22_jƟ4O#UOg&uoIv<5`GjѿIpW`*wO!Tj!?bЅqשb/FQǏ5QM@Z+#赮U׫SgC/KPYse&>]W,0I1V^ۉބJj<Ѕ*zz/Arha}xx/! 7BE#uF Ok9TJ93*t+a[[Kdv1'k^cn}lCz﬒Hr]0w֥eֵ+̯IAEw_ 4-FP[Xn"P69oZzivcvPX)qp' 9K6C.v% +{r|c=v.3]|ѨͱcŊ(Z(CB(>)ix3 c $s݁+:? ;>RO 8wIHQ<#Ž,% ag:׼mJcrNn&?ѿ69[u|#?Mi)yNA[m='69D6'zK _xţVG$i/#+Ҽ|!`A&r9|tsǿ`TR湶# t o^ڏc*4?{P SS?v<_|0V!l[Y~.7Dc"ԃҺ1[Ү*0V5\Uh8NZ2z]LHiw2fM7UD'!n~^QW4}6 E:-Ai'i窌jj$}|%λxF텸Q~t|c!ls[+I6:E,L$F  ..d34Hŝ<{ס%G3e%b#+WLM)}0U$ְF+Mr_4|36|Ҳyix2;XnFowQ=Xlƪc#ҹF9Tg!%r*< ?tv?bXnj_J^EOQKG?um~\y7F~YG:Z1ϻJ9U׆S^%Cq3XuwTCdЊ x#z0I^[Y G襯`qSh ȽM'd?~usu7uV̶4~YmbO:?[-IP5 Ni)IϽ%|H3D)u:կ ^G+;}~ޑMz7_M?OAKj/22jԼT[wQGFis@Fn &@FnMhL aFK缿%y~a^>+\Q73KJ- νZu̲ƽ̣i%2םM=ǭW{^ƽGxL_.t_1~GC~k{[:k;sOc}eSŚfA| .8a?JK]nv1^=n lѵm*}k'r$n_Gm7Tv p:z1xYE}[Ӝ}XQ@RTz94oa9$ïJ diaX<|~&=6Kn9"FW~u56׻?y=ώ38't<ǏxPoSZ'uj+O5n :P:\ܺ&|6@|Ui˝MҊCSO՚MUFaSWK_]7 'NNNzu+ r&4}}  #K/ ww RHS9/!?v"kPZ7b}aރqP}_Zg;Ĕ YS Ok,9:{4 `(YRJsJ-4bX3CUOPpk{_ dbw"a++s,+IWgh+[Z|(FeeeaFhk_㾜GVX| NRW}4{/U{7S*+yZ[nfgC tm +\Z$ t;:eDl8yEE̸w=jŎֽK{.Up޴a")YMB퍎zQESR{ nx/zj}Ska4DQGz;_{ 8w6]C|<}pf=ATwyA<-H67BӶQҗho}? n7P(I4 0Ғ MhJaTG@ h @gu=V3B8:5,o}? >̟yO4]WP[sk\d\z+-n sm4'? :_!n=)gse} _Jw=*j][WX> endobj 55 0 obj [ 56 0 R] endobj 56 0 obj <> endobj 57 0 obj <> endobj 58 0 obj <> endobj 59 0 obj <> endobj 60 0 obj <> endobj 61 0 obj <>/ExtGState<>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 62 0 R/Group<>/Tabs/S/StructParents 1>> endobj 62 0 obj <> stream x\nȵ}cw0j׽ 2Xaţ[ ȗvEu7f>6luk_ǟ?oVOOyonϷ'O_޾-)~}%JwTS*YxMeŗ] Q[|}ūEAeкp>w\غﯯ~w\_Mq HiY岄m#rglRk6KQKBEwx bGn,pDĶoDJV {T Jދ:d#ޞ\S Le|J:  L"!!w$v<=Cjwѻ|FWݷm̲}N.4f̀+I!}_^Խ )BzӓFzB*8,E~x=='dJ> )i/p÷))UBi]Da QҜy*fafFZF3Y?SwnCl mZvgPwyvu,yJpq"DZo"~LI4Jv4#;^79^G N&/A+cLɐjcv?~z͐iQiửŐRۃrOjG zjWvsOzx96 ;هio?Ot׷S3>/j_?B ƟR_m3\,0wɐ{RsIx lk۹!y;FXemb9^G͚S $^>%zS0/Yutˋ^I˕yƴD<#}yGJ >-HGFˆ ;pˉ$!K"tapJۛ_A4oyaTEǕe]zYG-4zDXpI@.:pr|89 OyW܀&Lo~#8)nwm!^v2s^B yON#N[%I7-o1]вNiۿ$SeDsa'dcT*d\P)jИ!z +WV]߯hRmǫҸxu#OVʭ7䋏2y1{E{ W)Pl+*EAwʝuf|԰%|܆t.J_7U+uM#o*tgv `dSǘfY}|l@ 4QD&H2Oǽ 5?>!Cypy%BS݄hhՐ 6*c: 6IV4l)lhZclLO–.Azv. m|XcsW̆%#Hj{r4v2* }VwSk{:FРq.IMjݱuPi "xF~$mpfG C#ptoЬ ŃčKKHV9ar|nѳz=h ?;nb5[ qSMp9>+jJԆ^)sM!jj2 6:!QS:4JSn*xV~C|f.P( J@-XikʇGlEh,ː۩;:s|p xBɱ 68WiE4BW(Lm'He%G Xte(,AP+E+ ""j#F@/G+wqtZіG#8zYG5(J&\;ᑶxMcQ@6Qg.\3NbHPeS.Ω [7h!}*\MF_9QU ֑9$]Rݶhn,u<}Eš81L=6($wg e8 47B:Rk:5n_)4lQC8%*S%x5Vh#=gﰴ}ƲT:>yoļ>&B;`M۟n)~96=ZCT7<_] .x!觡i?{p-:YΉ3uzX6hASޤ(]6 "w&tyM [&d'Xelr<=&ӛ%KQ2BlJ䩩~ Â,]»Ob.(Ϳa% {Id$/ Rǯ"`~2~8}=iAƌwMd"̨eM(hEk; 젰o7!^ sGk$ƙs텥YA&KZP1mN ?(w+>~1yJhQ(ݚv|dk=Y4,wHfYɒ{Vifj- %wAXQU]/8Yeo)ҚĢ_5A endstream endobj 63 0 obj <> endobj 64 0 obj [ 65 0 R] endobj 65 0 obj <> endobj 66 0 obj <> endobj 67 0 obj <> endobj 68 0 obj <> endobj 69 0 obj <> endobj 70 0 obj <> endobj 78 0 obj <> stream x\}\uWr#>Z@w޻P)Iz>b{îw׳cac1؋3[^^ NdbJ% B+jERJuҠ l޹3;}QK{{9ykkyf[s}-35agiCY& Ms4۶5t9jER |kiͧ}[3t|G3 |ti]n"U,j ͰF>ӽ^YNR}+tuOKu_il&u+Nu:lX[3:qIIՄk In&>$wAn Bh  3imx.EmġW`:N<:A'KCLn4Ƞ _3}NLStVh"Ӧ8ô4KdX:`iO,56`jN|:4Pi`y">O|ؒu E^`$:k hhymW41}?I'h2bi$C'p fDŽ{|1+ :G9Ss\ױ3-hHOnv4W'/6j.†@_sMؐtr-8k \4pm:A.tw=L_]KBBr < V%\ydh:!T^A<].y۠p#`6_13 #WA[eo C^`8tŅ'n,B @"#le0h0p<< b@цOI#$T 9Ƌ<`iq9 l,k܂$o4Dg=VDNp09$ 80-hk6 ! p V:pF$$#\6&H@gKa.:Oa[+)4 vVP<)Й8V]^\k , 4'wY lUBV0Kg8PEk0-Єm bi g*]$;] ~  !`]APaª3@Ƀ\vqCŸ1>0™dVFE Ϧk~8lA(Ƴ! %C^fІt`آp6FLgZ{D`^%!Σgx%<˱uAgѣd)7= }K&N AA[6Z6KӹɁ;&&'nnқ5~-x?HB~D="<*5nozܤqMFoy+87_ByxpWz29nˮ)DqW}G)X[ ->",VSW!gոƽevϞXQoxZ+,o4_6ԟZŃ7㈪^#E)1ں( \)J 8ZLHQJTuRE1:HAJrRTbw/RNbg/uHQE.9P`&[y]>z|\i0W̕G,`y3XD n1;h+Qh+9dΙ:q!(63Wbx曆X ռ54Šksjh] +x33TO<2 x7mikflω'~\z$]̾~bzl5p3b c^<z"3=.ؘ_Z2h\ [R1Z 6n[Lc[Ҫʕ'm 7b4uy .v˿\^K)Ov.udydG'Cdw/bq_ZAF y=7 3bH*Ʋ?nre,4=1|keGwx#<>}50?}rU3oq93q~܇SM⾭un+d^crFv`qi߲-<'!$Hͧޗ$\_rѫѫѫѫѫѫѫѫѰѰ\s%RG6>|[hu+^)uI\)9"B젞q$ L[%vDSkg{7>7RE5}vyG{wh*-Wz7ao>Gߗ{FPL.l)ZRW'\DqV;̽ ǦdP }L⽹Kkt$K m0swvv&뿣6wt($S2 ybSUM=wG]G:hO9* 87khޟr:2(*xM'+Vf Ua47^%R;+uarAF$ 37z ^}} H.{o]:!.4Vb%.{ՔSc Uk-d|pO|Bbte m Cc].Zi,JUh(:Ջ%Ź,Sx䙑+W \9&rLp1c+W ˳XF{Qm=[-NhB8- Bjuʭ $rI ʝhD-wXK^{)| B_ TӫEýOfn܀J̒4MKلpbuFKF~\44%inb%DOGL-d<#]+M'FV= %YO->:[D7V%PppK3C7t,^M!D+q!LmrM \7%nJpݔ)uSM G4''FFvMc ۊEjITZۻgӶ}w=t.ڨ@QXs.0_+4(oO )VZJ*j?Dƍ풬&du 6ʟO9Z C)*gh5]Gr(nhd3o:#"PJ^gz VS{w=|rda5ax~o/Л;uI2 }T1>lD9S܅ʕw4\hڹ!fO\_/֫0AS!목ܥG!>ƚ$f>̽#bl:J(zc(WZ}<{åRqSޢ1ݵ{Q 3?|V(Ԥ ;3;)\S @pM5k ĂMܗXjz^G_ bnYj^No bA[+Z~[+5E l5?/3ӳm5/8b` O\9қ5\TyKuQ!KE\\x8"{63Lc}k$3jtI|Cx}ccn^.~kLc;Xՠ0Ea . \&}<_#;qwrjP :r9b87o+xۄ.=.-(\#e{>riKf2Ɛ3,% ؒ7ޯI ?V,fGG'ѡ▾}Z Tő[- 0iڷ M{HD1#(vǢs<#Ͽ:2g q7gt?M죓ѱ{wLND4[F}w ] U\toV7q_n _W|3#_ƯAd o` &?I2kUU!4r_S |w?=\q%2ELd"Sc| X endstream endobj 299 0 obj [ 226 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 507 0 507 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 507] endobj 300 0 obj <> stream x\ xU>5I4mڴ$iRl@١[֖.-P6Q"U7QqIJqEw}wFQe_qf^׾y?>2KƇՔVVu&ӛd,cgS:FgܓĘ->$5#fƔF/(9{SRr3$0riݻL2p_w1y)c^<2GfOWےXUםĻɘƖ9Vdl:Sue~<:483]oj{՚TMpMHg5[r);|SOnX4g}jEyA]}XwS[zZkXR1k5߱4>ΖtZo(߲˜Lgn6wѐ̲ ?]W/okq߁ָLc #C=;NhԞY5g3@{.g./dzfoC]Zb+SGuJR*9^;EM Fʒt {ßg:5>3f0gmtYͯ݇Mym[0lRe,f1YuS̫a{~ɾOLѳ+~g_9)0`36x3]Qs6T8^6Dy/?=ɆܿwV;,f1Lkş9K?3f1Yb,f1Ybb?g,f1Yb,f1Yb6m,f1Yb,f1Yb/4 rlfs5;oO'f1Yb,f1Yb(ңi{N{69 egƲzmb[6==ӻ:35Nآg:iuj:u{}5;!ڟ̟:JgZc{o*Əhx|Vi;_xi?UxMԵk,^ey'4iNcCY3gL6*4r Ǎ3zTe%Ç0d {gz\I-b3 zpֳ_^ Ԅu9#D_ G˄5Z1%(xL *!lH^Oo~S'VAo(W{{4=VӺ-χ2WS7keSjJ^\/i0df *oiC&ܲA 3ŋdžUenZ$l}fz{h;fUaԲuaG _C/- hlCa}m=z b R3 =|>їs;l6։U J!s!*sURDOir[g{zbl|#Vsjf5 mhҼM K!ѱG bU|K8? k0JN* hp~Y藷:(Ouҏgբ,JNY[U}cSlV}`5_P-VowiOjalǔȍ&oVj-LJdر\ZR!*f-!Q fYZ2Kham8'zOvJu5G;mSs}0jrYj6N.| \b]07C Ublb]=qj]2R*|Ȗ {<˪GhCɑdWlW[[};SVvsMKέTó~g^v&הଖ#k^uv[{0RV4_Q毬:?j{xv"GO6OlS\QRR3= yU۽5")^-MB¤wo2֪4L󙤏|vzP n7u: :Lkҹ&E}L=I)* T"܇qmxnG4wom k-MlEIk=CE#h#Mbeh_D° ]MCxy[QVS-K^7sPVCc5l7 [ÅXo~#v>OXltj81U鬩IoGg*s=>Ԫp\/7}(!Ppk] U슺jK TB\(Juk~MZVͭΫ=F 9Ԧ>G<(-W >8u7VYE7xX5MъUW=RL/ <  fw4aٖxs8ķЖ^"賍y-.Z϶-QSAV ס#lTNi%#xQ} )m=_+^h<jW6n*/o@4a6[X;(sp*%mWFqnꖣe~!um>&p%yg˩RWx#yu#Ij4DEA:73ه=6igd< 0VR )'MqJ v[UWn`T =_6=4ݍ9I?^JIqV<Q~*oG7U+/_? ~ b:- T=p g'%,Y(+%eBMh3r8]-YR)EgHJRt)KqJLSX*)KP)H1_yR4Kq'I1W&)H(ERI1[Z)j%L)fH1]iRLZ*)Nb!)&KQ)$)&J1ARbc-()*))ʥ(T)K1LR )H1XARIQ(@)HQ E)IW>R"_^RIS=.Eݤȑ"[,)RdJ+GRdH.[4)RpI"EN)"E)RؤH"^ )RIa(A :)T)),*x8 ~)~b?HbIH_I_H{LOH#),ŇR| ş-R'ŻR#R%śRQ7x]פxUWxYxQx^]R<'ųR<#R<%œR)K!6))JER[S;,R^ۤU[YQ^MR\'ŵRNkZ(ŕR\!R\&ťR\"R\$ŅR\ Rl<)ΕMsX/:)JF y嵇k.=\^{py嵇k.=\^{pyI!?\py.?\py.?\py.?\py.=\^{pym.o;\vpy%[PΎt9 :RgFR UVJJ :h9iaS#%eD-%ZL #A-D SyDD'G@'%j"CI/5Ph6Q-Q ,ToM#JTMTEt"dJID&'G4h hQwhd= 4< *ǀJJS0$*zCN B% EDDPcQ+}zQn)=wDoIEH7^z-2*+|%^""sD=C4yIr>A8cD;@%#D;$DGJnԽDm%I.E"@Da"DG突ۈn[n&F'Dt5v-;k(j6]ID]JyP+]Dy]@t>乔j#:h=:g-hM9t6ꈳtљgq"3"UD+ w:tU?h)DK-QD-gh56J#j&:$Th7S:DD5DfҠgPϦMAOAUD'RwЃBdJID#IAЄHxH"IAc#Iy1Td4ѨHR#F< TIZ*$*$GAÈDDC#x(5$ &qQDTq 8@"O/ K%Db`#q6zQ)'_x 6-M'{^y j|K/BSUs~~; $K%Zz͆ ,cpFeUDݴ)cxp;f(Rx@UxCu>lޮlf)A:oK$(3A &Xn+3^M#:ar(bx-y8qғKfc%jT$+/AZ|-,p\bYaKsko7kwo<:Y8 8hV+r4T`p X,-`>0hNNMh:`6P `:0 TU L*ID`0Q@0e@)P A " @?/ <'z݁\dY|] pi@*Rd $]DV8t: 9| p~>>>|xxxxxx x#:* 2"< xxxxx xxxx xx< <<<l:m=V` ځ0p7pp'p=pp+p p3pp#pp= p p5p 8 uZ` q9?8sq9?8sq9?_ p8bG 1#p8bG 1#p8bG 1#p8bG 1sq9>8gs}q9Vkw7nl#.f\ğ1^K#Il1kZ]fol5F~{g?aOcVu3.usCp輇=Ϗ}~NC"3ku㕗܇W.ҝDZYmj|eo=f&lfV׳&63s2kf|-5ysو,BxR X -aK)j^MZz)[Sil9;`+4 ,ҧX3YLlg7u!eagpTB|].~].gWb_\ͮ9{濊]ˮÞysDqvF3"Q p=[vhVablmё YG8%:jVhD++ 1҇GD˴9+戙ZK uw8S̪P7@NG=TvnZܪ)Vvl3_.vra"l ۊmcxyϿ%lgCb;iŗ<QNGG(8{i {=Cj$R/u" Y<_fGO>9٦;u~d|2.w`%ubIlk^u:87t~􈚋՗TfdEl,Ǯ T=qKIf=8KKMyƇpQw$h)Ҋ TGEZl܀yw?Ģ=<Qo+v5j[sjЬ:E`\sqP1nhF#@ڮ S>hL23{)rwR?ǟhUI3Ti:AY/O5͖o+ļ!iCzeUA՛gn.|p&g$L [}_~,5xj<8KlRtCGWWj).vݑl2&:u6ҝNjX fhP%w|s/+-v>[5޻Ū[,GkVBq&>PlF) E.ֹ#0JweNC+%9Ww|_G?!(:!_?G>g`nÍ`Ѳ88qU}nv[ x-m)fcl@mY bnЁ/, '6;csz+bExىfMV|61#etKРܪL,gjA~S"EQCbzJrݘ=lPQF/+êS:;#..ΔkaŤC=dæV(fSMfs\;n`YMK-WaSsvg^jN^juqti{AI D]Bɹ־W7kH<ÀT#fȯ2|ZQwج>r4a}ܬkߜ^ʇxϰ>)_<>{M:Uՙ+{/g"7+nňd1Akyg6g+Dm;8@UZEQ&鰥{z; &OqwI%u\Õ`Wn0,FxrSL:!!)ܹ;dw-q>=^ Wh;f.ޯ4MzMN4%ĥz<]xvxrSRU*IϚhEbq|T%5O={ݺYZ 齜3/s*EZ=߹ o{3KtپNwST/3d.YLD䬌8^ .*>Nݬ[lތn.-##7lN޸+3 ˤ7SVF q*D#qAӞ:@[g>?^ɮkwjWZd!ɹjr~鑫aU{j\ߣV-:^1d`OILt )$_ Qqຣ|sԵrR{_Vu}{On˖qDag ";C%V"KB2!vhK(]iJ@(Ӛh)mÔ|0Ci9dYdu}{9{^,_fQqR Jxo$[pX L牢6n|ILJ@wsouY@ԂPYIպRsYA+9\<Zf5gh:mzXouZ ·Y`A*3gTs\#I>$٩[;:UlAbo;uWn9[V_ /罼&OX^NZ ,j ٍe5g#O{/]ӌ5´= M+M;F%-Q:wz Uoz:e f-kxgػyc|sNЪ9vl޸ε↫7FGjmuR1awbنm-;6-vE(8Rm)-.-jYYW3:ӻ>k3|/ Z2Osդl^ ɷʯdr6lgpG^"P_,Ptϵ;Ae2jGbݝ5#s׃I{-:SӖv*^mjMv؆F'q^nlļH Z6PgÍTūNЫ> +2^9^3#1zD-K{z)}==Ľm]q헮ķ_a*I4U69%қsQx{-l-)MƜG9%{Y]JвTy6mEEahj+Pƀ'(b T3yL26ux:j_-j|y~h*ɧLzzɳ) ?sfk}vﯸqXbxWm9ɨFjAk];8!k/enZh^xۿGto Z/ׇ?[*`6I`'軈{'SO\-#_OXmv2̷3nH*Eʡ9 )glXVkF4Ԗ|?ELLMMv nIm KXkրŘZAiB+m,t^uKW#21wf$>4њ[\j´H\ wkCwkp-<^Qiz 33 `Z</Т-֫ 3wߏ$c?Qt^>?I_>?!'b͌VH??Pd,U?қ; Y AfSjVGy1伜 =g1 *Zi[V[Ѧ29O2wnGA>Ur-)9$@W6KV5BJ,%Cl#9K QOxvWZJKP傟Mر5CVFnA}}u}Pٱn}$XopuUnz}@UOSQnێujUy6G-ǺV&Ŕc:;jZybͨ5嘊6 ZXUq=zcobok)[~E ~+7.zRN[&0^hEKs $\K[GC`iy}PX]EaX^{wl!V,}mkhW?u\mc*f,5sJKJs/GU,/_ W7^VQzs0A# wѲ`F[&6mlZiZMuKͶU\~$isMx]EKWe^XR&YPh3[M k^E7v=׸b7sIo6htvѹfb WPL?godnr aZֲX _ -yX] 51^}~[m)UHm+ZgGH-e$\2d?\א!%\ױzM}\7$h9M$R~78n Q}JD"\ O N\2դÙ'5$I%O4quu~@*rDZσ$ l|\Kz꒞geHzBFg.YKz꒞g.YM?uI_$"i uBmiU40zWiʞL/%ޠhmM=7$LS0 BV0h^J $~? _emEϙ6so^hp z"e_ +89)ut R:2|D-(2c`JQ<*[fwe3)waY41^9(^B$J~4-] UKB,fa>ڨ&1Ij>Y;ջ-EKٝEKWLd'k$"" }N rr镓E${K^ǒvT 眐w%IΊK~i~)~/g-ܩrk5 Q5s c6Dߔem>xkWg(qB\,jG7ג~)wO%VZVNE=)ס +6JR,!yI23H6-UIˠž|f,3w>YeQ ft)i&!A@;RR }Qo/Ywe<)bb$ VϿ/`DzI(.sOGz酫[ m"DQW -bD ->ۊ{ԇp0Օ@?}QF҇}@k?t Z5o((7\+.gX*/H6W>O끾ߋm @7{pΒ8^/ͥ%#s~w|PfA4 a 18^3:~Zd. *A7gSZw>DI_Fou/PI؅+]x5w]-}8nGOA*x$!轒wJc eH"Gm)EֈԋrlsBAPF#_g6ߩSP89EUdl"%vXŸ Ǣ5'}ɩTR􅒡POfšx(::LJ&1%(H{k+[K#) usl**tѩpRd3KH8@Adl&TY"$D Q?E1 P0 U D8NcC)8G0/NǠCMB/8GpjJLΌ"!1qI HSiAh()q"O$BI1YS0F ~k:eq2:3Je2b<kPiH$6+NrtHᨘɀbxx;J9/T#\910&ꋂ~K" ř8zd: O`B"`Z:O`ʟB_hr&O]C6P5AKMC"է`hڟG&M{$hO WK"z*_'Sp@rHeC@UF5ACI`l6TL*Q Ӥ4SH|F!.J a\'Sp'(<,% k,d_EkfP0쯉%&kU-P^#ǔj0/2E? ỦR{q\(aj$.7 \ڠKH@УK$̙tv16.J@gA'@O# @ȊR< G@3UEGHj(Py0 wsFWnGشS ]4'{ %pB3t&i%0Zx2DCt,"E< )-Y(Tl"s`&aBA01e [cp`^PƆ蒑yX^ƒȷSt?-Z&8SLy.zđ_}Cۼ=*\r۽}C[GEyGġ^38&^v=;}=##O {{;տ;I!׽!(w ^ :ߨkk'o w –;mb6G<8g+HC|M}bPw4vdi(TW;=M=5Ln{_6x5 fMnD;B:c;jqE^oY}PLrP/k ?d.5d@E%6{pßË?χ0000FC1dddddd=)|/(@Kg3a" L߷[a00@L-hD;Ko6#KoPzv[HlvVAoUpHDbdn&d iP}^&nտE%? _뀿7vWh,uW{5? \@{b~&jo$p+3o.ꇷ.gߛ_ kp}h?ATa4G<>q h́c: ;}4 vfSV q O4ž"}cFs,αDrϻݜhnq^e4?|(A9E3ZScy:a򠙣jQAЅQBgGu*E(Z53ϸor34ǥn>z)5ǨVǧ>2 pn,/W0~Z=' =ڲrZgt={@?,Q(zS'a $N#8q*bj@rZodUǫn黥=hh jƠe{^4 kWʣW3zm-ueYeQ"DQ%2tW=:9^O", 4? Q}4AvT: SuAЏSG_ I8]WtFq Fr()ջiݓĮD%nJYK,%:$1:1Iz=>lɞnпh"ir ѿL$HL8@ޫ L> WI(U$yD0ė~r7:"iC #E^ Clȿ+tㄭKv 6دoBtmeIiʓ a _CAJ}[yG?{7ȏȿfxd)z_ ͏_{ߓK2:t7wCqrCQA!!V"!#vfqq'ĉp2D _s_5!!n@FLk!BGB"a"ތx+#~nB@|aE ::Qh΁XXXX؄؎%Q]/b?/Nw F "E#Gx /7/![M,фX("V"hAe`/.Vc`Z.\}+* b?RC\-F%(Z. M,x'yve7.'^8sD\piW:^}7/IZIVNLpvu& R?J3O1W 0YXc0[=<{}EETSUê=Tw~zQ'pkzm{/w;  .a/"AfS—o OϪVJf^ KڨSڗort&]nTԥtGu>_ ?9}Bߤsoa4l6D 2~aovʊb {ݙw#+I%+I@$(HX$ " ‚HN"A$+I2d$6;w't}U]U=3}[;컃bI1 a:^P :(t|?cimtFŅŇU1,%lXXjmaa21<.<>Bx)S燧o Oq"D$FtH1?"-b[DząHY'21cdJi"#/DfDaT\T|T:QQREF͏Ju!*#+Dסĵ73D~$ wɻFP Y9G@9יsW<_I1hA 9HɝA?s*('tSzP2La)X1hGSQ sk k,_]aj bܾ@- +yQفr ^$ R|5UZʈ yبqEWsQ_j۪;t` 0fX +al=pN%E2?a&U>iD4v8Hx4.׸M>4jzT֨VZcM 5UԸ# cY$ ɝt:A@q 9%LoO1 @:T_%R5N~0 T a1: N6~Cc 48Bύh\q#/ebШ&+h4ӨdFMVtu KM+9̳lҨ}ͦ7=o&רWbez$j5)u$KQh2z{4RdndbsԻ0%ې"PCZO'=S7ב|z6Wok8oC[vTv$KӲFm#>Ae wj<G8U uެ{N׸00 ʱ@-Zo !A yOXn&LS)Hn;}2aQf"hګ>,z(ƌLvg?`WU>Qz&v+_QGh3vt|v߮4VS]gq):2Wb/biZJ@̞^5j{\rۧl$X>4N ܳo?WW}u;384v0*xt3V'rt1(׾2PGA:k aTis`)}p yJ4H>(1 id×F=ǤqV4Fjy~D juAՏ#(O3گFjy/GF11zړR rMiePA#RTGRHSu0Fehh53xLSuM5uC`䟺3H^˲Zg?#6H/$WVsA2Ncɹt9yځ?(7#OӃՁ‚_8&껰{-P.^nG=P^,Evk5$yA@yI.($GepNj>j7Vfmi+j*\eczzzϓzχ㭥[[e5އ=uT+nܤFEpÞg٩zhCnss?E WSO&2PAI&zB'e+ Bֈ5{{0ϒ`0gl,evFdw]/x<<x> B0uaO!w]`%ƻ*ރPZޟ(> 1| n |5DIQ2DeQbĄdLelJYmmVlgcY̞3]Xi7Vzz]یe8~*io||U_O~9z`0ç)i3" bQűȆ%Lٱ4XˊXˋX+\X +8XX<"/V"6"?ŶI|=|O< v΢v.0~'ED<}8@A8Há8T3QG,Q$~_R8NJs8'Ҙ N),NiN<ęyEsEED% -~+*wxE\KDUGQi&*\%j\#jqqx7fQV +*^7Qkwq?o!<$yBN, >A2r!VĊOObSl %56 v; ;AL$x1+v)P {a/(}Ł8Jp?p$8GCc,qP'דp1ALLlH_)_)(Hgˈ30ryF>#QxՌFt }n>&A)сz4r`g9.Fmd3bFI>.jix ix2l1|pw[O{ 77*c`H} #fbF?ub 6Mb"21C̠3h,_(1wD}tWԻL("M$VUbXW6Vg)fgtybAљF="=oz::B?Z +00 4G( _ hO0 Ra2L0f, s(|kwŰ+~'X (r36R [`+l_`;JQ7 . {`/ŘpB:Ep 8 4şp~U܄[p]!3*_ ހ7oF1o›Dތ7o%o[6mޖ;wN}>{>y:??~ ~~?/_e~_u~m~}Pb ! a +BīxMMDS\%>'b(owbX*~/bUwK{^OA.Qaf4~7v=^c8`4ҍCaq8f7N'Siq8g7.Keqոf\7n7[mq׸g72 /EYEVK!kZ|Y֑ȺUYO&l(ߔdcD6l.ߒ-dKi'wd(ߓLe"ʏd7t=d){Odo#~ Ar"a39\~.Gȑr-cX9ND9Ir*/t'7rV.E{X.KrQ.+dIjF?ur 7Mr"m]*wN%w=r'La<"cr%g9r*iu>Y[ݭVe}b>X}~vwb{ٟؽO>v?=hC03{=ޞ`O'٩d{=՞fiOg3Yl{=ڞoc/ً*{^kl7ٛ6{inGI}־h_ }˾m߱ s#1s9wN8'Sis9w.8Kesչ\wn87[ms׹w2>1 3}y}!>gχP E"}Qh_6_//֗×ӗ{—ۗǗחϗooo/7777ooooo9EPu|Iw2ݢh {EhU6=(:NN8$FpTcU:INuZ,K2FY<7-bLg=?<')YLdVk 'h%]~J^(uO 3] 7g4~zwkovѾUz"(nS>HV#1=#Fglչ>|FBhQ퀞PW=a=1'U=Bjvyi`/W@ Hk$x%%sR ̰;͡7o7sfl%ȶc@nJ9fRfdCʑnv̍fVO៳8ʃ3`Z6|(/5+@Շ[{dVnQ*ۺKUǛTqc2Uwk Om ̛ s'҉rlN݉ur89\Nu9'SNAS/m߿η+sPc؟z{Q-wSkڇcl*'Y2`vs@nv'?ϯ0΢h1 B$C>Խ Kdi6{eX;(aB)Yw6l$/ЂO=?S|( 0Z=?ǿ*?U8"&H 3E( DQ T9.c 10c0o-5wXrzz\<#Y^hXgg{33,b<=XvggKg<=X ֞T [*Y0[--x{o--6O&o%o%[[mVVc[556omom>mm~66b;ͼ-ovvlO-^ՒZ[m[V2;Kv;G'v2-as1vS˙=}|Px6=ZWO^6z,[U%Ǩ>wQ9eO BK+H:Hm;,^iV{L-V 6UolX3eƙOe4 ͧ"3fY,f7KϲN;v=l/ Kga;Žc8;NS4;βs0 qCmqG}!; Rꎃ~U*LysOE}q/Z}lԢB!>#-}"D_=铝(Xfq,[2OЬ i6+LL6Ey^p1MŋG"/^KտMRgi H+U(k䤵bo-~Z] eZ?KUpFU}_'Ydk5՚f}iMXZmZ?[h%zuϺoeXl {{=ma{^n};>l'S}d_quB˱9:O;EgxS)puJ:9S)s;;N%Sũ1#0om90'" IC-iyIsxZ[ШVqjmW`ķ[|Y%%IuX b&:u U3(w"BmZyUr+*wUUU~]7TnrwC;2u {L (SJz.FǢ+vzh!K c11yUy}U4\S&w+C\V쏙CgSSG=C=ʞaʞʞʞʞQʞʞٔ=c=+{ƒݲA=z,G7uSP~ʔrB똡YQx8UP@yLijhyi\[ '|86Ϋ ;]{'CmNy,TתKKYvC5Es|P>\xwѕ<)~8ٝ]|#HCP;˶Em%kɏV9{eEng UEj49# I@B[P$H " *9I9*:18>-.F[_ |VsQf|nOg$jm +XηZG"ts]IGnjg]m)?i 8`9 U:-XUyzlm<d${-{.$?McͰn;1܄F0M s5zXL;Wuz:=SБZ\g.Ն4cfrӓF㝁֗JqF:XS8(әLDNrTֺi:833˙ETyYD88Ό}_=>q%tfާRo&p)xUwuu˓i KW{| 1V]Wϻ wZ1:wr2h9h;)z^zpV5KV痎Ze8ìl[u9la:qهgŴY*SJ|v*%ٞVcU-:[M۩ pt8r ιZ\Nms.9S9ll1\N}s.Ӑ F|l6v;MaO4uj7csZ>^vZ8-|ipƞ5[;9mipw8ws畴ClCSn֎f)c{D?>cC6k\>}ICk?O#Ka187qL+s̪ ٛDV"3El56XOYk&{2-{GGF,l(r)O)֤Iv'i\&~rɳ'O~5)=RFܟ:p)_f6O:>un=xZVi&=)ds"zzSoK. nFAF=3㥌3*VXbÊ,KfRf6G#3gg!@@iBiQi 1! &@@iBiYi9!Z 6HHK -CH+ !u!5@Z6@iBi miv!=@ڇ\H BHG t !t)tHRHa;!'@z" E@Bȍ@nrc~!?@ 2 B@  ! 2( 22 CBP C !À 2, 22 #BH # !2*2Ș2X cC8 「 !L2!L22 $ B@rG d2!N w3L22 4 Bt ӁL!w! '22 , Bl !}!~ ?2<B CC@Py@!2/2 BB , !y#!dE@@YBYdIY d)!de@@YBVYdEY d%!dU@V@VYBYdMY d-!du@օ@YB6dCd#!dM@6@6BdK d+!dm@'< v C ;!;3 Ȯn C { !{7Ⱦ~ C !r0rȡra C G !Gr4r ȱrq C 'b1&[VEZ j dڨEŦ!*6MQiMKTlZbtDTl:s:!SYMYCU.5THVKSh=H>gq\gqgqgqP |vP}S/wc !g$*"iƹ^z^St󜯻VUՊc2TZC@Y PV&PVh66&ml-~Վٮ66ů?;ܹFC#qzOcBjmp%;#XR!oi,oc)Lx(˹3^'t,uQHiK>vYFX>(GA1ʙЎ@BL1V-MǶz՟-<^P.E)HZ(OR9e}'Zp;>TO+}Yh-d)TCdkr6izUEYR^jNIܻ !e<>nG*5*=0k.D7oX]ݼ>Va rC4XJ3 TQ [Km:meT#ecmx=fisZqOfF9@j6kue]ll1kq\;-)~m̍SypUynn9d^>Ŏj~7v۳>'gEL߀}ԱvYq;3hٱ3؎5:@js:ϔжWt OemK1:dAf&_y~˼gJHSSWs"{zǪ@=(:+/ڏE譡OgY|6^HYYN}8y}#THh*?kof 櫍YFr8MvfIa[\ƾ7Y6Yò:n{Lg?{@/:QՓQ,ĺ9c%J_PnJ ARcߒʧC]׸X#j2 7hѳ¨ScWAЖD+U'x\iOE؞LDw+""L'[~y/o ,ƣ"vA-V!֫LkX[@S)#:+>3VeGez & ĞI{Z9Ng=#y%z&_A;c$ 12q)zOl \kiZ?:'hC/E9>%gT>1yre6GWnt@`PpHhXxDѓgF}.|ї]%0 G팏N#:9zgtJt*_}<_GD}1%F1uD5#U[V"zڌMo1b'Ƌ v1QLwb8 C8"c8!OxN/_ɿKZ*TJQש֪jکzAuT ꢺnPuW=TOKj&D5Iݫf_jZ֪':^mP&OWAu\P'zCRow)'uZSԇ#:KҺ.5:GӹtE]IWUtU]]nkXR )XB4]#,OdٚZ*\" YEoNJt[Fu -Pw)XݧjF!u6m:mWo鄮ѫΧ?Z6T5bxBQlUlOb)vb+wqV|+ΉyOqA\eIҒ%G1r' v9QNwȇr/ȅr\+!yXG1y\Ow{}P~$?g'SyQ^9\TMUjڪjƪjZBTT_5\Pjƨ uWT-S RRnG:Cә:K%Zh՞uI]OV9X?iY%YmYCYSYkYgYwP0]XXyjW:b/H<*bX*bX)V]x_| >TYEU|&&>_/@9HCr&69RZΑsABjK{^OA|C)ߒow)'yZ*ʨ*[]rT9ʫj!V5T SS]jV|@-TEQzRmwNWTEuI]֤-mN:E4]GV?2":t=Ex#D}le;͵|pw_g_`ٓa㸃bK)lQ*yt[kOrFT71n҅|{qwloCW•qe\yWŕm42ȱc69+_:pvUocQ^%c{XJҬ 5UMV)XTS㋏,*s>g(K"\D>:e!MDS*/kϪ=UE'":.TMr.Q?ɍ~WB/HR6mjϭRl*KXXv s/{io)VJY~qKrQKw-/闵J9VZ~Uޯײ*uV5Ъ7X5V-Uo㷵}w(jzsOlzt3=Q鉯5=oz'6=Q97=QU2=QU3=Q u}M↲~u5]6TV Xk3QyS'mpx8sMF)p+ry+ "jڔ*5Yf,-Xj3K nƞb˱zlHΌER^ 9aYxhYqu؟qL{?uv1 ? 4cM4G-ˑamڋwzJѫޣygZ}~ n=߷~u_/g_ۺů׷F`[Z07Z^yuNn[gŭsbZT:Y un$βsk:9uUl*ZcVl ]ҠTjL|v^^TvzuDK |j uEd"ZWh@,FԭLT`k&^giKmb7sy&aIQ3yZSK+6|C9ٷKsv.N%%i yG|"b(6qlg(&Bc3ρXf/Er\}2R$}Y,úVNgl(5I˗+߳}UF%Mw;-OIS /el*rT\UIUb[]ՠJVu+UQ4gjOS-.)!Bh' ,cwq9m@̐1jU0o9b~\opF-c=!Z&D"S2[MmGO}|#wǞj ,$qc1Mȿ M7o[^TñZ/+;NͦCItG؉qQ#HzVi۲ =uO%R}ՌQHWn9ᔦGꑔ-󖣲̡8H3J՟)]Cn2s4nE[•TuҔV"s*TS%KUKTnr7Q]w;ܝF!85w_t_+}s_wߦS/wussecUoug|RXf1_ͧ4[H霩}DZEu2:n,-Man>Vs+r1ʘ[̭Vs6qYr[L:BMnn7jr{S3ۗu{gmٶlc0.mO̶f-loƎS6%H!Hm6纆R Ŵx&wo/EN#eoo_P>H,UUبQ777&gs9+ gf8 T{794<_=\Tc2{O+RUF '#.-{-j0O6P>v& P?[rjIy}5m6cd,R 5g+tۢlL;ǝV۱^6wmi4ud ur/$u*ykB].^ Q! Sozz}{{z{L}L|@}aanME;5`]7ߏ=7RFq&?/~v2~vW991~ ~SDZǯG&G#+GM|縞=QЙhiOQ ]{OR]d|hnjz6(6Fqm̑rKh}ΡS3vSn_NOCr{Xvl'Ipv#?-݇9Ow_’؊cr^^,2g%8~u)c2gUYw?RTĞyZ'0?lz:*wMSCX/?XWƿ [vTdkɇbl15!.ox%ց'jSB_;^1,1h{l7_#kkzOF)== /5풻8'8$N~GDY"EJ>/9%D—(c?PIW~^j\h/${Tr{9)bאhcdRlLbFJWI5_^%9ejM4꣙aq2YNcy$H|oF-;@{dF}!ӿf8$LZ$4ʅ9ArX|@K!/w+ՒNXvdw־c]n$!}Vll՗͓9Ծ=ThpU!=b,jn䪤57sk9hok/JjfH gT%9&f_Po'z8KR(?ET1AcE(F_&;A6)r='/ac+r4?Ƃ)̕$Q^WFV[ bBW@+! Bo*䢥 - hYEC.Z rѪV\䢵D5QD}H4 IN#MEс4D'\tH ]t'/i)vHAR|$ŝ )IqWH{@vLN@v:ᐝXNtdƲkq<‹-h HB[G[-J-JAF\2 ͐T dU!q Ȉk>>o}}6}6}}}ގlJ͐3M=%S1<嚫DĽUNeYs!Z 4`-kՓNS#5&Sq S%eaLHoobB;#s?N'M , ,!驐X~/~/ ~/̓ 9ȀiEhVh[K5mR }6D= 'O>h>>>>>>>1}b0#'FOB>1F~1\ (1L&bJ&b:yP>}ةbCAz}h.|[[[+[+[k[/փ66B6:G8gUk!b_VjsP55v H0&"*&R4d i{c0SI$C:$Vm_mھھ ھ`EZ{ֆnqh]h#eeSGAECt@܁V*minrjo/hv ގoǁ \9Z-$WW'KK˂˃+kk5555o'''w'NN NN NNNN<|8y8piG3s̞3[g, l3zz;Aڎw\ŃI J$ no*xcT5ƨzco!F`o mfj~wt3@!ﳞ^)ҽˍZǣ N@6jDQ$:NAfic91ra3ogsz|W5o!wiN|v.k&#djl9Ϯ萞k;;ު榯ۯjn!yο'>w_#$s[ĺ2qwQg(CQ#UЗ `[)#}aK&M,T{G=mC[;[/j> F?z,^P1^ߠIܫ磟NGPH޼j9RcĿ5_гѸ {OKpPhNJPh]JtӪn*%b'ܝ=W㟽SJFvIcjxA\{Zg8GQ|4caM6 <%m#MBUckWOLы'ϣVU*hg% 4+ʳ "UfUYuVfuY=ր5bX7֛el0ʆv/`igs|-dYl1[ʖl%[VE2^akl+{f!}>aYγ>zгTzPz^V+a,qZV,qYC,5 ED+D[iVXeьĺzz8WoWoK+ӕI\#\#55x]c\cTgi,XIVpV"aedX9btN,eDVU"Ifv3IfUXRUcH jbERYVg[H!kHJ)"X/֋f}XRcHY6 "6g0FQƐ 6%6Tb$r#¦ar3ΦlAl&9{=AyldO)ŞfOl[D%l ˖e {cϲgI}{4`ϳIC! ҘcH'MF4c&Ҝ^%-^gl;Nnc;Ҋd;Ik"mػ]r;vlCڱl/i};@`A҉bHgv&]QvNS+;ΐ9vtc߳@BqѾ.?)J-[vQ$U۹ٹY{[Ut@-?N}:]}"q;NN鴝Ag3əQgtHVu,- Dv3yUɪbUW)VGm ;ǫODT.ܛ# EZ_s{/vZOssa""zܻ oXa+8O_/-g/T_@ww0 !{u>[E^$"{~=V[7L=`7C}TyJjK ԾՍu&<֡<8%86ʖd},0XXX XXXXx߹5;5gs?W{t`?_9yK'):ΧYt9]E_{t GnjvsZmV)+ݺIqY]5P#@G52!qZaYm]ku:le['SVutp$;eʎz&Nnގa1qɎiWo8v:v;9:89vvw\vg3srWx4 ,<0Xxf`e``U`5`u` `M`-`m``]-zF&f[-m]w    x?p ......>\\ | )(3`6s1/'{~<x/^{1uq 4 ,0=+W*\-ȵ|UqjM0{ Ԝ3RQf92 :R ~l9?Ɵ+|%| __/:2_7oo7|;_-O;~>HxEkchm|QR$RJ?b1C-Ӆ!BɛZ'|ZoWkC89Kri4 TNF J3(霑>$,iXhXpvXaa_ >.,|:,|&,|6,|.,>,|>,|!,|1?K~D(m6h&9l@VuهpU猦~Me:GqG2cCIУ~fhi~/ =aW~m74[CO =cYCc7M[_Ҍ?%~sHPa p :"FE;L$Q$" B{+: [EHɢHŴ#&JQJ֚(/,QQT7jH"Bz| Oi|:?gL>s$OH)O|ϟ S|!gE|1_—e\{ɼd,~Ғ.%hq+ceL&HJk[) D$,&Seq&KȒY]Zh^ϣlX#{}~9ND9I> 'YZee9Y^ 2CV&y,Ȫ.kȚ*=|//\Zk˶l/;ȎIk;eWy&eSkϛXRC֒eYW"l(Ʋl*沅UV!9U>,!3,9[Α^Z;Yd/ȁrNC09\#(9Z? 5\ 9WΓz'\HDBuD]q DCH4MDSL4-ĭM 1X C0#FQb#cŽ>q'Ƌ bh-ڈE[Nވ$ŃbxHLi,;EWm*ESEWZ'!ZYb#Ob/ SZcTg,H,KRL,ψYR<'VjFkKbF$6Wkb*M]%vN%!ſ]$ZH#qH|,O8*>sqL|!/ Z|#No)@g9qQ ~eHr|Ko˝KC+)w=r|Oy@~(ʏ!<,?GLfnڧF??&ر7 ޣʡ=\AjXAʼn5JzTP}sh~]x~ v yzGJ=ncVcE0fyE5;A+j^R;=:T:ΧJUJ{.0888...C&%%!$o3BuŽbJIC>7٤4t=/d¡zL0a}v[VlsnLmE"<ݯ[k;xiOR<|g,O{ _˞| |8Y{-AMq```09 F`C }V|fra_k{drr Y8? glaI6799qsA7c>\  \\TM^K5ytb_N&}?.(Tϔ4?'MC=nqsQ=nQDъRc 볓LRfsyiF=/h?i!V}X+#5 $!?+ԉg~hlT6dxZ?q7xxV)9tzs \| 8҆F~y@]R))%堤rPRJ T q1*z/A]T?g)qB۱}yOo@lm G]"VjnEڭHiWPKI] i^djĘ>B=*/!*]+F h b+ ///U>K_3}&j.h o}aΪQ2%4*_.V I .>^Iͺ%~X Q.2tʊȥ />%WDh5,N+++++J._?s313QN/e']WW+Qx yɿB 5_Q&<_py^{W|4pPs  88$=h+hĞCaVF +8ho HAO&&k"GɪuL@"j_@&gh|h?sp?%'yEԡ"Rm`?kWӵ:{}L9vtׂFy-v/,OSfɳ߆/Lzޠ/ `rXx0-X2xkmςPJ  S% yy"xFDIgA;)߲sgȶ/H.'TE 7e&YD)]F)-(&>ҿ!_W(كל?oAVg2ke.PF>"d-Gһ.uS\U&XDQ7m/_͍_͍_m˨z57vYsc57vYsc57vYsc57vYsCƭzxU5*bOT3%/N_aR8\f 뙋S\^#N]Lj=Ij{G "c3s9Ǩ!z/;oJֲs*ܮUTRC[- g53+@7p437Z_ J ǒDRVkG6h.xڵmo$GT͵IyslU)uPC͑SH-ck~cz yI=ܼMfdַJޚwGGN5,2Gj]ќqJ=qEWHn5l0 ll l;ψ!0 xxQUXX,`uc@kp.p-p'F 8 x5xD`)`%`M`#`+`G`7`_Tg SS[1YGb5⩡V&HmRGLڑZܡVgIrZܥf5w#>"+٢go(0daXx[ڬ>i@icJkF꭪FZlDߦ9@vgɸbzT>P}KqVcDɪSTT3T,FRj$)Frj4HW=᯾''iJZW-WCg,ZTzTUjcuYjk:m]q;\\3\YQQuGeTi>w̨)1scVļs(&]===ýŽ}}}9[.flرbǮ?W.U\!qfƭˎwƧgį1քuW|3!P2rB c'D{=m<< <<{g|ÏSh5_N״5NXDaߥM0.ɝL5Xa'M4Vډ*r>KhTIRo{M60q5NTTo'vHEkq'-SMJ()uڿV0Jw`hl.I>j(Zi).[Zf6'[o,HIx҇2@V˖HD;[m,Jۘ˕>mvod^/.[ 5\()S7FIlڼjKac>R3uV۴{˕H著b~Jjr5epceRce9.s5>buϢэһGy0^ohGy/z{{Nݺ>)}n Re ʹiQiM{RnvaVK/Q>vëZG/nsTʱ.4Sckύ9uK9zv3.r|1!S3ϣ'Jy0!W/['|c86!3!}%3+hfE&]s['"w&-tjR){N]:1g_rÅ);絘y~G/-Yo_l 6,x' v/8pn[Xx(1|苇 X4s닧,~|wq]5wmg^2zICNǜr9 s^ّS.di҆eemݴlԲY˶.+Ys3o\}#W,[Jʑ+p垕W_ՃWޑ+k'Q&7b֑MKd=ϓH_vչ4)׎=:^,uA[C[lOn=pjVM} ֯-3Y_7&mn!qٖ.$mvFTbu:'mϖj SiQV6p-!+n\ 6kd~`O뽾:i47^X ckSdokW ƥk-.zeRnyn9iOq/3ˤKsuɊzuzj{l/ں7\%uLJ8 `ۘ>_ٳ59NV%_}.*\܁"Ym16Y}=}1BO>G6I軦o69!z\lw,0vFO~6SF3fkiT{ALԌdJY蝮)Um7Mfza-*e)i5WO~";\~Ԥh;\dwˢMʥO;mb츍N}/K+%Z)4R.i,g&RK}\W":kgì靇O,N=zYcN:zm]zg dܣpI;5E~VTdW#NG|5l~:m ɀX$bȆ%KC,rX+ai<O< QsI 2Dw]L{D'"vYf-U*My8fE@ JG_Gl y(<p*|jy+ҭ==ΕyGX,l@+Xƺ bbH\O)#z9a&,ra@u< oQqq*z@C۽0 ŢSC[kQi:AtECzȶndd#d۝dLm,6/},S䳖22F%zpZr$yir):1¬!6 g?{=}V{}F_D/g,keҋ^e;=͢~Mt>)}t7#?s ;g%SZb/ͦVMoOYe˷T0[ψ,AcƶמAz+v-`AXaJ,Txc8<OS4˰8CBǠ (r8~>qy^*¬n?q~oHU% QQOʸGqxGqisH_\~$*eA\^5}@-Qǻzxdf}eϊeϒamjƒ- zVh2GfL#3}d>2Gfx:@ɴ0&dZL E "cBdL y>D0 W$k|d5>GY#k|d5> d'CE΅p͇k> T| Q=aTzUTUP4! CCE*[*ffKޏ-쵇؅mt}DxOB#>BGT4444444444~@ʮ]Bl!ssVeΪY92gUd欟9g~,~q'e2Lr/kG;vbޙޙޙޙޙޙޙޙޙޙޙޙ\3E?s2 s9?{\{\[[Zsޖ֕gK# B/$O'W?9_HΫ伟=0///MwYֵϞqb NOZs*XL=OT ;r=Lv$mMm! 1",t|;zOqrC ~HO)ן~N< +D'S̅?a>,doiG=~gMFW_.k)1=. V3 w?ʯhі3egmO\1,.Zf觯"u`dYFցu`dYFցu`dhٚhٚLe"-iHDZ&2Le7Z@nAo頥Z:h頥Z:h頥h9h9H|kCLNK$pvK-[B_Ġp+d'ݺG'D,7 zup0n0n`Ca 0nQp [6XHq0 k:o&x 6۰ [vxއ>NG1<_R.v7ᅰEa?|'OADo+3dA7$A>,9ˢؖ<5R U[W o֭vi d/sH] WA'ٸ5M] ei\ ȅ8|G?qCNgmfYn@ Ăvp@"$ז mm#nqۈFܶ:1~1~[t.nUd=T+X\?UP +^ +^ +^ +^ +^ +^ +^ +^ +^ +^ +^ +^Q>ᯰ<| ʘs;|_y삯a7pĶ = vn}ZVZ9>oFžj{b31[Uw_2N}z>sA ?w;+vb;">g ЖwgNVNֳ;w+,sP*^KqW@ h )>.CW\ ݄#Z=ǵ?ƱFV]ᰙf+ā !DH+dhE v:@G`6ic6iK5p7\}sR +>Ap8x>&.SMI0May.z}m d `5l濾joຑ~_W5xU=CJ۟e}MlRG-p+;;T|;KT`=^Rƹj%3H?j~/Dy5w[ܫˠy 0F2N1NG9]M*'dc28<OS4<%<yx^la#k: ހ7am"^2(,4d;Bޡ0~U-\'O2]\uOOS)[WHsȧETM%6TbSM%6TbSM%6TbSM%6TbSM%6TbSM%6TbSM%6TbSMq0 0Q v#8YQs؉ط6t< O<4޿}o#mľ===/!GHX axT`\y+q1<ƕǸW7 \$_=TG12FRHJ,LEewIę.xMvՑ]uѕ0FWJ] θpƅ3.q g\8θpƅ3.q g\8θpƅ3.q g\8θpƅ3.q g\(P%(P%(P%(P%8x,,Ő K 2O#=i^)rʼ^5' `1RX- ̹0<kDZ9['E(?#f1 VCW@ h ZCh R=tUhXUhXUhXUhXe, C`( 0F0 np+ > 9 ̅?<#̇Ea RX&?1d1TO7ri%OE&.q! 8e v;N'BF0;L&b ÄaBF0Q?a~èF0Q?a~èF0Q?a~èFo@o@o@o` ˅Br!v\]..B0Q7a nuèF0Q7a nuèF0Q7a nu̹l[+tٽF$I.Gb>{KW^>'˨ghUK+dB+d/>xppppk<*£"<x#/yȋG^<x#/yȋG^<x#/yȋG^<x#/yȋG'$ģxtNI<: Q! 3Da(0Cf Q! 3Da(0Cf^<xc/{؋Ex\Ex\Ex\Ex\Ex\Ex\Ex\Ex\Ex\Ex\Ex\E…~9ޅgq~Ĺ*¹*=S| N?'8X8X8XC|eX .*ࢂ .*E?.qя~\E?.qя~\E?.qя~\ǥ*\¥*\¥*\¥*\¥*\¥*\¥*\¥*\%\RpI%\RpI2\*å2\*å2\*å2\*å2\*å2\*å2\*å2\*å2\*å2\*å2\*å2q=.p)ƈ uP 58ukPukPukP7! nuCBP7! nuCBP7! nuCBP7:5S:5S:5S:5S#z2ge8WOD`#+8u+*WCtY(B&j&jjSMU}d_5WMU}d_SFo[.K?hWhٔD,7Q_;K6+2t k]@k>k>k>k>k>k>k>k>k>k>k>k>ST%9UINUST%9UINU{@=t{@=t{@=tص8C6,X d@'c&E+Ǣ+N˯e[|s*3$ ,x{+? QVj%GSZGPA#BZԬEZEZT UTTQQEJ,E#(xKQ ` `I(X(X%(X(X(x*QTSQTSQLE)TDZEZEZEZEZ:b(UR(R*JՊrc!JyQh+h>&'7):N?EXGYZ4K'1r\DwPm6r5prn2recq/DT&}.5|+O<~~zrz<\\vJ6_HևiPd!-huVТ-N[>;1OWqF[\If[&d~Z? t2d2EoZڋZk[ee[kmmkj] (mRQ˥x[6IpK=}>:g\<>^";x:ޱgyb+v#zx<'uVnaՊSxRF>SOs}=̞7]߮ߞ}avGIou5X[{Jid]m*oG6\٭A+2XS<=ɞj-y a'x%-D`%akyR}y``21j !8&\8Dž͉IcP˧i^+vn],X8{0KLa),1ke=vZVV{Xkw؄h.ko:uXU(`{u|_kõ5QSME[BG;?Ea=j5L4<anT#ƵV>gϪNg#Gq-w6歔)FuQe]e{yo3mM|_:ŖNSlߝbKv6S+:2zZ勭x-]eV>)_ЄfƚpK_עUc#6EyKmyϛ8-߆NcG&6Ջy;oGZR^ ,\rWU2aRlYglzo='ޜ8,\8ܽ#pTю1bޱ8.|/qpp—,sd6٪M_/oOO3:evy ;;;%!1,,_quKz퐻^^2L%9~෸-w`s~Lu> hg #q 7gfO;ǜp]u 7N恓郛e?g9ϽB-y1^vMov{kuXzm5`=ҳyrћwOkͮ seщvyvV`f7f7-Y~n6t۱瞰8{|>s¤~WjaqMұ"%ƈcj*Wlx|\?pC^;30#!q?+M5Dju56=z;HuHuHu(0Y:fvf#|\3?Yx2\-J\#J_/Dv;2;{];Ϯ}WiǾbǶڕ vva]vv<;v;-;f]r]h_p&_x^ZV>OZ &ڋx]{ý7 sEZ n16k@ioSmFD,zӨZfosFUΉ9M# eQ~ydeW2l bonٟOٟ[ϧϧϧde_zW Q}E6[&-W+ͧdS~?mIN>69%Wr&/g6kkVjWkZ~\Sop S22c?Z r1?xQhoXz(7=VmazVϋkXeawfA4nEF>Q>-D_YO֋u"kZgDѼ("6 ױ:AlDe׉z ^H E(VX(V'EU"*jhU SAt*NuST': RaT Q^4j:,"KUz #]ֈ kDfѢYdhEf+UoTFhRVoR v|`7 v|_g`:`7[z.o˛f5&긨{Oe:'v4;jud춮ku[ڭkukMZӹvD]c-&YIv@{x4^>Oxy/x4޼\޼U+[ʓwO-ԲO-ݼy7ղQ-=wmεFvbg;}gxo3֛Y6ͬn]0:aD;͈ڌhvi363b-zZzZMlXQ֥zmVzgl];bwyy=[lNz{ދz5rGXjKܥfEw[/EܔPO$.N/YŝfwZJgڮdNJomw֡句4m 1 KDISHhcFئ5it,RcWt6rۮ<})DKȄB;ng5츆n /[1ŖXw#>Pcgx׊5w9`4NclLیkqm5ƱSߝfnfmf}mO>6Gj}@ͱ=*EL_jZ2acu^uyhň1ó9bT:`:e]/ WKҿ=ݸxyV.XaҼDbfȳ k]̻Xkk0WzZ:m `Vgy;"oE"okq9u4 l?EUu9Ʊabkr])zMT6b(;a[XɈq;-MFr+7r+7r+7pp6n6n]S#3˂{(QyYb5L}'L-Sv˔#lY=2^L.utzlN1M#unݲ[7Cwl2[7lG,t4ݲKwT%6X. zVRTE3hTGSQF|:s)oڋϳ@Sⷲ`gw}wf~ pyXwyWi X&4̬̺̬+ޖN]ɾ+?XC/vaTϖ[϶;v% }|[Rζ+mW~Z|gtlƧj)bj)69I1QLo׶f({3Vuud_GUOf\Q7mMuFݴQ3mLSqN'q>3i|Y89<|_P3ŗqWq> u ^){-<_:x oe]G]G/Rk!Yq@xb@VAeWPTv`Cl wN™HO3 T}XR'|$O:. җpgz*fX kn ۱ս.塾2$*XI)VV!jdQ~p  |6,< ǎtꫴUu}|Y4 ,Ap"N8_. \o[+C>p>>ja\G|$?"͸o[܊btdZ8+:ΊZVtmEg[Q:N ˦!i7MH?sZ9;^;^;g3;%J.4!WACp(8ZiZiG#88H[WJLp~&UeaypmL#2ad워}o2Mƾ܎;0w|3w܋p?b0}21cfԿzKd%NJcEXQ},M4}y>OiOiOiOiOi|7AeCN&D9('dLr2QN&D9('dLr2QN&D9('dLr2QN&ʩ%jjZDZV-Q[(SV%Xed,ŲgU/9&ff٥ >Gmv6\->%qmX^OK&-U7\,HT-Utǖ~c2(+ee,岲\VrYY.+ee,)vJn)vJn)vJnۓSC !x$ 9ʜC]ZuW,E3hFȢY4#fdь,E3hFЙ1ә1ә1ә1ә1ә1әqrgHB7z{Ћ'd2X*9'3Ry_^WyUBAPP% 2Њu!V)T * c0&}U5*"(+gUEAEQPQd̟UYTq8CUe(A6u|:8HQRYGAQPyTGAQJ)q4%h èaTPlQå_d?~iP-PKeRRݛOuG(ő8rGN-\U /R /@rEQFM\. Vf*e V(jeT{#}.cqzT(m^R;4bCv) QCj8[ZUɨ'bD14 PA+bJh,%Q[jXm-bE)Q( i4*Nb}ZRMSYT,ji,4ZE-2jZ?ϫjZ?ϫjZ?ϫjZ?ϫjZ?Ou娮ՕrTWQ]9+Gu娮ՕrTWQ]9+Gu娮\I|6VkGίkW9;a8~)r3'=;;,|秱3䫢h2BmQ&К6|CȌx]MW%R|Y/Ke),ŗ_R|Y/Ke),ŗ_R|Y/Ke),ŗ_R|Y/Ke),ŗ+lYzQebI7&|bYQ1ykEhWөτ?۟<]szz|bY_W޸~F;A6°F7¿>USFO|"cq FX]v!oۘ00?/K 7wUewn܃{q԰0 ߄BoC_dU:^>6Jt󱽉]}vDOH'vu'5%zC*ocb_s=C}d:}ɪd&}0$Yz?ύ/&:\007bnD.4%LgQ?b^/%,",x57&F+yBMh07J*ǃp NidhJ}:u?97>O|R2 UUQX]uUe_U#BSG)h=cg3L0ݸ>܏ !0̣x WK(Tk_7p!Ƈo܄9~_W ~[qn;q7c*B0_Ux_()Wˣ{qaz47bnPP?sA\P?Xcs~ϱ9V?Xcs~ϱ9V?Xcs~ϱ9V?Xcs~ϱ9V?Xcs~ϱ9. WٟСfPvY;ԬiiFug|fTWGwe,6=4:JlnSMWMWMWu:p~* jXb5SfLi:h:edb"V#t bu@:#}r(O)g_:@[h \c7c7c7c7c7c7c7c7c7W;z5Q;*h{O5-fLovT .hi4e#M٘6eoİf`x` Q0&xx?*U~/q&F%^H¾'^ވNH,.` tv+p$dzzĦ\SZxpbaϵw--.[eâ!ivz|cەdnW([.-KQ9*sktϗS㌡6Dǝ-@4⯾]9Z+8{rMjg#g{%!QRHUȠYԠ/N\B]洐||-4$GGCcp q17ab4D-?D>D>D>D>DM>D=D=D=/j.=6 Wd񯙼n7h6yɸ{lͽ&PVS2×xߘ41"VUuamqgӓgE֥ё8R?gXч}C<>;%YUz+ Ӄ<9ȓU=54TnFO5.4VPj/g{KEE\1 UUU#U#U#U#UEaSxvJ >'f#m4%4tVy魷[ߞj-m owjC]ZZY.r{ߣk*#Nys7zXVf]}9Zͳ{OtHrq85=8q.<_}?|xVimra=7Pgv!:b@%G'b&Z0V׺w[nsmd'n#;ټ3bĨ4ߌnL(y"ou8q7>yC^[%D8FT\}D*dDCEŻES\ltqio oPZ^u|7-%k:e^rw ѡ3?ƵV"yq]1]]c\4417EC_*XB1/dgYz1?}~x:eNm4Vq4Fgѳ|hhQ< 8 :űq ECS'LOO3WiTM~)/Uтmacۈ=kS?5ȸcO^-4}oZz[v-}[]ٚ<1|^#$vs ’dEV$C'xһJ+һqbzYe_XKVE)yjZϓCĥ}ҧJ2n^{s^T]FܑtEkiu#ԵQVjO+A J}2oov77IE;i k}+ǎ-~/?Z&JV\iV9Rn>cS̢\=Ʊ:{G߫5>.>ѷWTYRAX?߿No֧li]<߬9_xhQcҝQ*yeipA3|#;ʽw;޽drwÎYlr35Drz*uG~Ǻ~ڱ ŧ=bOŶW?3;޹IH$@ 4A) vE b ""R (EaE}]"ґ^;sobb!gΞ9SvwΙ=wW8Ҩڗ 5(>\k,WQZuk%G)KV{KG[3ȏbs/Er Ҫ"-zSqAPn~yԕi H Z5WGz \Ϧ4-jYifڐ+gkBz%SZRN: rפR++( {E'F^$vϱD2ƆhqơzM'{#us;b=;|{Q|_^&Ʒ|A6AS` %lH[*Rُ`?J2[ jl!jŢ8-SrQOg+DCшMDSF4guh6l8W6֢ ,װm]DW-9ޢ7˕)F@LxX+1CZ| >QX*W{u[[_'{+_j_o+~?[ |LI<[&4YAYI6ay[^m / G2H0?+2"2*2=2!Y+k}Oߡ!Mw)u/KֽYz&kYSdm~Q6ғ벱~C+[z<_?cyT%[oJE^E^ˎz.o;>CЇdo%/ʣ\zQ)Ѩ|,-#DӢihF|&Z!ZUVVhrBtPI9%:<}6:RN>}N#ߊ(ߎN,g$aBrBY97\B!ao30w"}vK&e Lڬf=ʑmƘ7o3qvis1pNJyҳƳۅl9?4X34g[p1Q2гәUtdv{f^4;YsXsm.;|aA0ߠxϕm`%SqV]l敊8e|of'D)n6')@f֜;ngFnU܂c*aP墐vT;~Ӆ -r1Կ66ŮA5ZrF=^ez?+OlяP-0 9'> #O"]DȣjNNCЧ[-m 3*>Π?O|u ~Ԛ&tV%^8=O⣹t2m bc~4!sjOĞz;f@;EUhDjLjEkXG֑EonmyaxλQ_M}z| 9 {^ii8l=-*4Z\'sxӽdZCd?;MQigk}vө++/΍~K3'w].(~VD.kٛY.|.r5÷ߖcێ !K:Tu7vЭXJVL9vGߋ!ChQc^%ya{b.ϚR>F?OKen&i'kE\Gl-n:fNie.fɟ=m1م*VBUn82'v@?ZdDf3hvts;7s%!-|sAfjsUjϾwuu8vM|b_0Kiů'_ceeb֝$Tx[(ϬCc{RȾs=\5:ָѤ50C,3gt&mbzNETeoW*8~1:ܻƹ ii:hens|hqij4/Wf{[؍VTӍg7 oD3 ᫹3-͊+vo:;?1\Jkgl"{Hüc0F,eǾἂlΚ{eWh)g{# N4s%;6W"5C9+]۸t4urz:tw-kOm6z{h6i;ʹhNGZt@}FNGY,z"ފn^Z{h Ɵe|2L| ?!M[|򹴓ǿ]G<_h"I$!a0GÜ/L9s*D#u^W$U.KmE;*XK^XNfxY[h=7vbT?f%J{c7{c}7w@=e}Qo} l}m}7l/c w7άw7Ynܷݸx 'I]/Xk|_ n :ItW5_q>- oCaM}mw5g'XY@ܯp*}MD_ݡM5itHT[d :׎c$Z j )j!cj" l*"hLq&x06  o8яh1H:卦9o5{JyQFTzv\fv\!mI~K]>F_H/P_H|:K@Y/e_N_AJ1vLz=7(#&bf joڱ 5wSC^mGA:?FْSң3/}baEeH)QFdRS(5 2<M7M?CdY^f YVQBYUeUW5_K֢$yemdY<yʺ(>6 Hu5A?]6gS%4-ȗ-y<_OJ^ /@p]W#jAވZnj!Ȼ[vGt_=޲/|Q9%<,|D>Z1j@@u rA @F!uM9 cj&ʱT?t0UNEir!ߤ[-|t!g YCp~,?A)SgkP߀[8?=?ɟ3OC r,ʅX.: r-Pru(mMrG+m!Jz 5E/CTI~GQ (CS(:(jG |Z?zPxkw#7Q0P0dP?1Ꝣ/H]VSStu3piD͈țK,DݯM@@JFխzH34Q)}5g_ÈKFE^ZߪGժ'Qh*QfhQ!5ղlhrh X; L还迍Rkxk5YZ;LKRqv.@1YZ9@vv|L`02dC/9E%o@_oĿ[t_L}2'S> "BL~#Lr{p DC"wC!@#qIğGߋ?A__BJLߝ>DL NL&0}h>D4Oޝx=D R':N\".w˻@&xXKooG~Ż1w8;DlݓغuغClGl[=wwSc4)ss\ Dg1w1ˁ#%VnoV.'Vn@\m_ ܀(y qGs$JnO<(y3nVn@\JeF //#퉒%%w$J0%%w!JnOܑ(3QDg#U42> Kˈf5DD31qPP3ѕȸx(q7.C+ )DBNQ, ˥\z3E,B/b}E̠1#4 4K_b}ҋXozKҋX?z+z3E̠1^rE,"K/bz˥z3E,^Č1^rE̠$ЋA/b"V"fЋX.1Ì0bKa 3?, ˥0 ˥0. ?/]Da? Ma}?_Aaf$EK3хky9Ap `VV4:|Fq66>oinn''{in."!H5=g7jyt CTg:/_ D'Fp*p*іd89)*35< _# _ ͍0 smsc{2\Hs')/ c iO1"uv*vA)y:?>yyzt 5KS6-F'9O69@r.paHLJLD39 dODmL"3iGfRf 4ϊ3sKt ~R}1"Rw!')!'}-:RF߄^2vDD}?'y3iDf&z0zJ~Җ蟢xؚH[F?~ X= q/ /5_`c#m==)}zQ @zl `H?雴 BߤS>[7iXN,z_(%^[`+@5ؚk} 6 *=`!=6U*E2f`ba>n6W;]_["ڐ}--E\z.,S蹰5="z.ԅbS)A(GP9@cY6ȱn}/#m&6},%H}[VY6upP?R[Z(MMm6Xz`]==c-Z7Q3,o\z0u+)eORzgXfƷ)Q@"NYPҽje ouk]ɖGS@9r e4)SB9V(R.\L ZN5(\CrF-)wH)αFz7z7˼e(9:%%@ʱTq*!a0H9WQNjRs?VNy53qKl[)'1>߷/\L{A9 ]Is\ͱMRr 5)wP lU*99sWO+^ۅO PB4A%/.}keU D V폦G9roi)|Jy=tߖRΦ>rR.\L*)P"FRn!%Wϕr\ؙU Ƙ6LTyA]Ҫݯ/Lk+0X̯5ޚ,itaY7Z3mb*ۭS߃yĚyq5Z ZŘuf=ngzzNX;u;<D846^Ƴį?=/+D]4اׂ2gpDzII='#WȉuOڻ"Wuݯy}LVspnmM\JtƮƿ/^D:<DJ|N]z{10KC:ne\p9}\YQ ~r<[$h/Ah}tYL9RA/_|W$N}6'z 7m_.fMPE '%/g5l5N5 X3qj5©kNG_.Z\S;b-E".uⰎ5X0 ՒZhYO'a, 'a=kmB幟6[QjZ/a8m"t#u6mi 6$hUi]Hi-ųh5պi- X#PuEd?{ۺ[.^-g+}ZvЅmԖAPBSZ݃:Mw@٦bV){V+2sg,Hz+W+2Pe X } 2RrҞ! /4A|d^ qiAN\Obf@a8a H)+fm) S0 2伪u:9 ehPcy%W^E3s2ÔKhXyZWmZk3 6,WAnB'zmS~/أmyF rW}D-C;uj\mr~24\,C{1rGZ3CU=MF Ư_j 3Su+ߠ5B}E=rs#uZ} LWU+CTG*UFjOuZ%(aWH-LQeƺ\"+Kʇi{EO\d$fFӕehX&w evF Zi-fAT2#FъAX_lgc@(7Jamnd*X@(?ޚܓ)=՚Sz7X7hĻ* t1[ +Xkt8{QJ1& uT4ӷϘZXFT9JpQ28Jt8|Gٰv|p|/:~7r bu*/8/{2ta=tn5/ЬBen.޿Lq2F3}ڏ*fhe24-Qv1ug! 5"\JQbm(ϒkg"/{;ւG1Ҏ\̴T+V%RP3R;S*Ļ)ՁhnqX'gbeԠ%Kk"Ÿ">ʨy vIShkF k:)⑌ZW ]JlsJZk}55{Lkb̲3h8;4`JQU_`7hAvAզt;ۿb\?s0;.fa f{{k1B̫*27;KV粌w Y&ؚ9;{~egV4w SRƝr)͒@lcҰ̂ì2!f;&ef_;$O2h9H-3Y@+k,XCc㨎e @ʩfQ] M-K1OLӌFOߨoEZ#y]M&}i:J-g갨#@L}^ߋԙH_c1LkҟDc1+PBoaHG,b0ZQTP WdD;lN-}EF뺲>^ia#:iNz@Oܯ.:hBOYZ6e>]}HYGE;>V-WkjPRnTz^֣RzTÞq䬛vT;T4 hL )oVS$RqFSB+ǁRs*8B}OƑso\VQ1HBjG;PW!m6Y;PTmw ?KX`*ՠ@/Ji}jg>ZխTMYQTuzH Tu2O}DYLԺ4OZ#(l:uOd2DT0~㇝kzU@O 8PgrGp+ ?H X1G|.lVl[9Zxg/? DUyO=5Pfg:S5J;B9-u b_u*J AЦSWj(SqaS(Kʔ2Hi++L?p&9wS5w\x5F&%N9&~iVY~BI9+~o4jo/'Sw|W,jŏƮ\Kى[S\cOkt?nVɖydXG5Jǧ%;3tb&gPׂW ]{~zZI~@?Myy=ZO;=ku?>;eu+ـY%J#ܭܭr[r%5eU::y5>#lhbI}z-oϿxV)ҋc3Z!n6A\0E0]fUg*7>OĕNd%dWa'+D1(r-18vJ=@\c11g_%noܭb?S1ŢԿJyjs+Έ=Kaϵ{{2M3GU7?lTN"p_#*;w~3zwufjzmk휤>Kzx=j|+/~WG3-^BSϫ Ld&V½}|/ Me쯬K!h#Of]KiF?nz㌺wW'Kz"s#~xAC5scyFz#g Ⱥ ypֺZ֛prŚ'Ub+ I Nɳlxy#❒!9..wE!^y>Pن6 a ṁ\ }Ur1{۔qqqf qǩ1,~sf`_R xc{D(qobb%%++!HD6v8}>9AwBqBwC˜mA yʄwQHkfC>Lhy+?Qd= ̤ "Y ee= Dݏ[[ooC)ϞpC!~~W"o'$P\y>)}m3|?#YSWtG3u2> A˼Cg}6uf}ׇ{}T!i 'ӱp)whnOcbVU[< ?9J%l!aƚ=k*ԥkyRbLNLF|J 5 0ĵhOe{:3؞T=8.殡rи *^gYᬍpF8;u3SA!ULO~j{_znzfN[IuF;T"َ]/;/C!pހk}#-CCCCCrrrryEPPPPG Z|6y ^ٞ>C<ó] ʙ \?_Kuچ…?yu)llS]r0rL^~s{'X/(JRC_O1{: GYg%‡ ;92y:-w$ ڗS++Ecu Fq8Yߊ"0/Ds0D 08= @D)Zc_V!u(]Iflb8+T)7RILbqn[x sg@Yv[-ݿ|~92tߺߊ[-r|U|C$Caʏg '?n~n~Rh &M"!=bV)@vՓ=VQ1ާVOfjUVZ3z3OV9U{jZ= 5cyqQ|gηx&g%s?գM%x]_vq 'NI"ddca&$`f4M6Ǚ~ztMNdqAd Y8K"~~T y R3QxGBIhOe{*S؞TWxsU*lUaՠ-hH-Ce?TCe?Cc?$jp.*QEs1Ĺ\p.fq. 1a՘&gcFFyLb^c'1;cIC4";1C\x xXuYwDdIٳouQWU_nUk$s9̯Y5{q1/~ʉG@T2(%c@Q2&%J&%"J&%J&%2J& %%AdGi*(]d !LCWQB%3񹇘V ÿn/x3^4xasLgM 6m 9hrFO:SNF>0[ - `oA_ԗUr}9^$zQ8N Z`5xIbq Vuh dR`MQb.ţϑ2ZO}̵B wHq߀|9&8sk3%lj-NJEP_>LW_4esB!znᏡ +(\:ß|Csz !q烋yq_yRg݈O+-$ҊOdcIXg YEgM1D6Śbݴ´8L+M”dZCLpK[>6(Zw ]+&{4^͟=LCQaK/A Կ 7-h2,eN'p߁\wR߅^LEV߮/t,j+˦)zeh4ŲFyߜ_سvXZZD`yK=O`IP3ONbiiI$f(d6Xs9,浠 ` r2E\j.%IrF137 $318KK(׷?r0jMrte{Zsн/._ӹ11<7 t&;oAH6X?6:? m46:lo Vxa/X A+Xt^ya0aFV:9>mM^ EiK+&qٸ,B|gI|+GtE4J=W?*X9NS=*m"8XM2}뙌|]M`uF"YO2Ҍ$3 g쾋.56@x5Cy7MqV}+6?c/oY+p'z):u-FM=ڞJZ88@bbt"^=nΧ,/jsC}~ ]PqM8S$UPSKMM8CoNmL2IOO-$3[HV[?"9o#_ש'I>qhǭOU8_|iR(1֗ӆO 5|`(! ^#,΋p8/"6j"6CH8/DAN>q~`4~D\m=z޴ĴDKKNK&~hաF[l A[m/hl6n&oj*i1~5ٸӸiq7i5v;Iqq8-?5=gz)ՔJ^4e֚֒LNgM/L7}|Ud5q/M6|1U|[S TOzM_64Ig?v /]L gbL ^XEV\iэ8] 8}=}Q$*Ҽ@(#ޥq6l"/IyM$3z\鳲X qf %}=+g}&1di6}3G-hB/AGk)ɛTdӦo;,(b%c$k~Gnx+V\~@ynG9->;^?KIl&h8i~8/KZẢovy?7fo*X߆ط`dkWazdІPA*Pf|5`6jOzqo'K[.j?Bg>Ozuw ?6kx<\> P EE*µHǵHFL`3d"PǕẤ׍_6K]-yz%W777DF^SQQ9PgUrڥJ\2 #~qڥj?xLb&^s/V_k >'䱸lM[OWոb9{;Irwzct6~s2ק}ޥxWdnih31g %97FZW,[Kxha| Dn SߒǘnQsd|N%sz:%Z,ଖi -構-^CKlqd:d;Koq%k8ջK~t|M9>ĒR˄P&4ϖFzIٚ=M8߇rrI>oN-)a|ʘhM7MK䫍s)8DK_KT3̀57۴yヤOh.nz{t*}o~MAw$̥V&D}q/LJcIWL2}*p.C1m D F\)5]a%zHB9b4⮇;I]&N̸E"2pX w=$*U!W~$W~<^w=aU itKEkAV㮇hf⮇{y~',$fcpCvz0=iDOc%z<9;R/b%zXVRp Vw=]+sxWmfᮇt`^w=<2pC,zX;p>pKa-(mK>:;[6y㏇ˏG 3uѷA<΁IBfz~tNH=sѭ}}c`vq'|g7gҜ~})؋uTmq,3@gu8jc>ō~<'^IO_xWH}=4DIxQ j2V3ݩ5wS^Ėpk?H^X>~eEyP+Q(XGc#СA1q!-\1\_xý݉ yT~O{m~?^G B9,yv]'']>r͖-G.%%o.C.1˒ѵec~rys7_\|WgS->|hؼ,2riqw~-< mgȓJZ;Fl:o_,Gcca^G1dO@3ՒEo=~)$%-91rxb;͸K`q疈6?GhEqMJ{.CGDJD1HuCq|Z>'_kPg:{=9Z߅^Pw {=K=מo/j ʴohw@T& $c+HydvF{;-*gdbawE%DǾާI 8/-x vF$A)SET[ (aQiQҦlSv('_PiO:)#ʐr\9=z92W^и2(GӡL)PUIqR\,+)(o5QMC*Q99͹/-.q.0 Bbmd9 tB@ur oP/2E<ݘrd7'c#qm6y|AywA8;oCCrÑ=;Qp7I!uI=@]>C(@K K$C o!q/6Io¯&WTWoC't n R C*J%$H|RH$5KVh.K[+04҈4*.H ֓vtp4.y-O̕os圻Zں\rGycϕ}ܔ{1G_u44ӏ]b-^d=%8Q~xV ^r }g[qFI R23,vJ[JJYRo3B(KDL]%=wH),-Z Oddݎ$b2gp@-0cA>ֳ&0)L Y[-Rؓi[-lVb+ql&ۜ*I;:m[mmm5[xh w=^~~Hlf>jxk6r?a;e;3{8odBߵZo$I i6"ܵےlz 2_\ٖDD)Ih ;Y!!t =B}k_>iBCB&6^ B` Z.g=-MB=a.~9R€_Ǡr/+{0 5#g'~Yv z;c0?q(ql-kAA'$M !]r|P )aAGʷp[6q ܅"^"ƻ'6 -B2$eTCrɼc~>0h·mlᷱg-.~Njѣ?ɍiqHy1>__/(; ;?^6Ow$p8O}exL2ʨ Vq'`4ʝa\^V3.w X]>7> xvpGf9:\_[peQ^4Dx0nV^f@#jj⣿: )quhaWE` : t:'E1MN̵yki1a&&F0iueRy6#z>;Jp@l P|],$9<@Pf- ~m^{=@@[f}Kی=tSO #{^k/%-Kxw!][~9L7!6h|?eGO➷Z[!݈0`#ltv1=>@zA3gN2sEf 3L N2SCfcSX#3Kc ->zFS:z2-0c'tlQs v #g= `Og% {f)i-#\ru4+, }!o⚹Vn+׎k>upangUw{nfy7'?bp:|!-l.3#@=y^E!ET:tP_pH'x qB" !0O(@"-8Af& bY"lv"܃= OUgCpE.n''ׅi-ӖζVl+YlM}!MfVVv.N[7^@zՀm6l..^ݰBcg{`ub`h1]s|PIJ9QxE\؂6&{}}A#qxZ<'^qL&8Fcf8q\JHc(eHRTX4%RI<4"RY"mvJ=^i?`tt t tt^{])ݖJir"fFL9G^'Rق(̇UC&Ynǭr;.ScxPG/WoȷUw{yF) JbPҕ,%W,D܀HgC #0 @}t>g;pNg;*:'x ')mOSޔfJZX*Nգbf@Y] [ثxگRBzB=Qϫ+um}9:m'x{]o7{=Po_hVKU Їox{վ w;q~p> 8b`!"wlp9p,Bva{hslspt8=4GhC'E58cpp"7W$VT+2*+* *aIE9 W!W8+<HE<@bAxUַmwc{I{:N0Sy...+lr jY ЃTG7Won^zzw_ B m 39빠4z.Yi\܀qs w<<< :o7k'yӽY\oл[eu{njmްmstTxۼ;4Mvy{}ރ# fA9p^tckqw;;닓s%G|)DQe7}%_{PHiʩ-ns1Q:|Až&˾-tmwvvC_/Js#wwww;ww*wwwEӴEuMsw"B\}ߴ]:NI~Tn~ CM\樵URb[i;ʸ@Fk,?t,Pjvν0^`"e/ L@Y'oGB 9 =ν@660xq(/F:NZ(1c7@WFj}I{a,!^$ \styTE$00+w$֤k2jkj jjJj6Sƚ`Mi\l;kvgk9VsT͙u՚K[5Wjܴܶ 5wkLI0>Lu`ijE`HV) vy]p`#Q ^^^  >jjk Yj4Ԧ26At4VuԺ5/6  6nѱEmmkW| ܤ)mIm#CQ?=9j>fiWTi7j.^D_vsBV2k'dTP8E%J " ep(/T B%CN yBP$Bn!z֡=~Ъ>E1tI i:8tF:&\]Еh6]j/kkh:P:R_TG0\)ԭ|غuuZgY8[u:`"14T׬uu[ڥ]u1u{5V\aA FsnlP/rպrNݭ;u3a]pK81ٖ6Y $\  ÎxDuhŶp 7[mm#Ýwѱ##Ix.|1<O')ͧ OgSyE?)ڛK˽T[szzO}>RT~]_]Y~O}o~CTOVOԟ?Y/_^3X\nG"z@s$3CufdHq4bq/G|P6D6E#ȮHg;7r 29 WQ-mDFclBrjFVN^AEFd"AאPalHn0HE!b 7drhmo(lPn4𹆖XC[ölÎ} } {g_eqyY"(H#"";Q"nZb*U-"E% TD@j-RJ%y|^@lg~sf;s̙'I̒% JdKVʒ%[Jl/UR]r&dz;;/aQx~8~m|X,>">ş,Y }ǧŧgް1NmRU+=ii2KW\zai+K{,(tP7v᥷Y: GKǗtJg)}%KW|*6t]M[oK~0DF YDՉnOtLtItMN%C{J$7'F&Nܗx8xij)y]JyCĂb+JLT&ֻZ[[Յ-5I?72wpNAqdvsyUddɾdq|^2?cڼaɲ~c=|29!919-9=9+9/0-Lrm*^{%JIS2fݲS'?R‘^ C^TeZ!e>n'+;ʡs:V:;W)27gIhY *RΗDNSFV5Z&0:5T]4TI:dSTCܜN4Y$3LVM^/4PYm*;X,U2~r22hu33Uc3WfReVeSmk)_Pxuj T]USI>V J}Ot=]_IZ,Jg<]ATg~XS?'B=_W{z?ҿ]wh/A?W?/wwx}.us~]Ow4;ȯ/''ꗃ=# z}xfx / ;umxUa0ׄa,l2a&;p9'|$|\'Két;|5|sM24 ׆̭pkՌ1 wߚ=^p/1"*RߔGNdFDN7/FZF.0s#WD%"O]#O{"D&y#Fx'FFDތ,#oEz"ZF6D6y"["۽G{2Zf 2wE37PZݩsZE:cY*T:026XKF.p?q|#y}cSb/fDŽزsb+;P*cc[b[c{LQ-Zյʳ6@g^K3/wj^2/)e^5*mfʘ5+]a*T`3ۙƬQ#/d6zv|aP+7;wvv3 jI^WϫzdTeyxJکf^gx]ijQ~ΰ=O8}Ct3U9Q>K=rZ97S 9/u'OH)$NF\TNEY騜i=>~rbʙi^;'yzž+v74}RjJw OX( A~۞Z3UζODg >{.nV[2A[[ Xԉ*aF65RRw&^OV}NUۧ_Wscj}NWoۧO=۾Uie=Fuڤ6}V_}Ujm/Vا6:::3vgzYnOS*)[WnWR5zꡇꡪkgRz[-*oףTg}X[ӏx=^]'Zg[-u^az^Jj~o>:%܌sՈ/3:dtPetFftnϸ" 5*oF#cHꮌ2nPرۿЎ}6ͱ J%ܦsr}+wIչr7~org&͌6fEs-gGE;FDF{GEѡDG>egS/EgFFDGEWF+[nnVGX&4kˎ5`Ncc}+o FFgtllcX04HڥkI^<>c XX{#$1kOڳfX/9~:k?koVۧ56????oͷ/6oԅ׾kwҧfstk__nuN_ίλbݰz{~yovkX{Z|;/o~X{>^W[;/ҕR ((T2Ɍ^5x7}ZØdcR65M7L$2Gnv<& aWێ$N"sH;gm:;?Xɽ㑻]rZZQK'#7;ɲ(JʝT-:H=t֟N"wda8]щ#ZS<${zO?'#cDGG?'t"ґ{$pñ)?Tjd [*ZlTA,qtcS/NmsSؔ=6=7DF]\ͭI-[)[=o(I5y 㟓ԡ_I_n2 }:&}3=O%w#=^$7&ZojK^;_v~f-~ZطS2/Ar'~9l#G1IHnm6/ɏ[b~pouWUyn珱G?>)Gݹϑq/M]ܳݲ vgwqO9]ݿc. m)eJ[vkuʚ`u%Nֳ3s-Gm[&7Kz=zeJJ)ڵ|i㌼;^eYo]sRI.Ǥn]fXZx*YhRm.56RA(I5^Z+FT*h`AY eaAI䑵ʥ>&S_80Ǭ(o 9,[G2wc+xREzֶsoJ -ɟέcUڿ[  ɘaB|> OT x_sJ|RO UUGҏQGCduPX{'6-lVB62J__ظCLxB|Z tL _dN5>E(\R?}RA<|%Y:nucJ!9.=x1L*$+*ʑxG~IGX|OtJljGcctwtJGq]:IheQg-?cl*Z]h-դ̉)=d^ɍ̷ܗI5ߙWX'0l>8-/_(Iu|$h0oȷGIOژ`ZcITB RqX\Wqfk"ѓ|c$|]T<8.1ov_!dۖDΊg=8Q{")cu:5QW;_~H+l["X$0pp+"hi\⏣%鯊|'WLCtV%4wFO~UÙ/ݿ/5;lyE8CgA?zpB&p Xߺk迂F=\#`7dd`- X ^G)3o  <4`5B{F~|}?qLW d(YEyqm.f?mF`Rdhi .~ 8{rhFܸ7~!2=BO!ѹ ߁X:m`'xO܁Вq#b}˴7ςFG,UAzz=tIȁ|z mn Bco><=߁;30O_ob y-6^јzd֨ j& ݪ v#n+3) KPׁnd izIG[j,ShL>]5XE*zZ Vj^WUzi F5XN*4S Vj -UUBc`z^5X*4Y Vj VBW m5Y*tX Z- ]c n&}6t Sw6ORq t+TKђuĢijpYM˭ϔ'󖹦j($ا/g?)k*i|=yY4׳sa.hCeZY^8˿sM/}Za|r+r8#5zje{AVOy^6UqM)dxͺfxjIs/>З@;߃y c=hucvW6b|46o/E[]^F,fXS#3 ={.kӠDPީHj][3A֕Of5`9̣+d6nn=b<]{a D2N8ͩq47c!ng0O"s:he[=?t<3z=1vu`=rg?۷ֈ {!y~A_Hmۋ|EBq8-m iLE^<3 ;Hu%󂦟-;-ׂ~͂3AȤ_4j 7^:z9CrCCKzhC"ZJ6rFk(A2jy25\L΄3z8*hW{/_MfGhf>%l)a #2 c;y&ZN5a#z0w}iAKKFZZuU-DJmh[KjE]OC&AmL;Ҏr?oD(72vqn%/4O;Zz;m+HNGf`p5N\z&Lq㠫Z,A3fmےʄ%z+V0ű[4=C{҆f+o?Ai ܃7{܃ zxӒr \@hy 3r.4P.3ڿ gtލ@]ݤ.7BGN GjX?KMg/yQNciz|)gB'[ɵ?Br+sv8}CA$-l]r2A}0#AKo]]AjݛF'k)h֢#73-gwڰVt tkoGiSZ6#Nwzz +c>+cCڠw3OSWܷ|?Gи*v]h.GJЋ8,c74ۙ7ۉB['9/BP퓱3 ZttyU Zm~NPmE^Ծq1AbVл+Wk3*~uZ;Bs\O_9-dBr\亟\ Ko WsC }*2ٖ)'8>h m-v刺d|'hi-A 3cz8ڰ&dp0xr4 VX:+XfBSf mGkZ7R~ }HkFXC7ڰ60CUuӔ]\Poi-H-˩e-mҶo<-M--N,ęvJ^ڙH4K;d#hr#h.G>[ڣ5ӿ^J;kE}~8)LJivz1^lGWHRm2!A3 |Ck'T1v.̂~GjI5vJd8-B|6y;Ҳ)sAJȖ =zuA+ɨe$۽w72Z.z6fd MKBrVNMO۰SMZA=q“|#A}/%,h38Z6ӞNhx0e3blF?YXfO$hiiz /rPBKͧ#K#en.&./k,/B?ki">O5"ɩ)_ddVUCoK f]D}4SN}8ԗ _o  ߁mۻ F] o݌wѯ_d;Kqx 85p6 x5&!򟋼_߇ ? fJVѪkyZRp Qq_KS׉c.B"hpl c,_|T=ශY)e%n_F]sEcv_aW-tNA#e_mS'l',}/%@ _sq㟱.GSS2NV־[,L}r+J%RR {:A@PΉ9Q8~GM  mZ)7af-aϡ_s6yR5fmO \7mNvrF/N#q(!; K %ZB c 5G8om`Jd8;wdwn.I\Nyg[2' ]9f!&z}q^&wg2X AI.I}2;R~Cu.Szluy=E{ҞHjgǞyN8/WùX<E8 3RP<-+ꐜßnUBFQo m85̱ OrG 10PN d;ǖr#T9'GiJd8##.7J䟦ƥPrCB(8Gf n(f (t7֋?pM~#ShohI#JhL~,|/H40NH X#,4%2hD. 0{źGP""V+v~83bT/LEfp(!׃ ڶNJ':YK{FZ+6[1.!" rh"1OX'o9x*ӈiD4/":^:{+jV1QWs?vo{+n'DD2ӆHsd>'W 2J* g5F3j.͟z:dbGPl .w,r0{^o{CO%{<+giN{6?d1#25pIc/&lGg·3n?1RQ\F %L$vMe,-6S%1FyG8v֬%tcr8p]I/ 6F1%Ci~ k=¥Dȵ㈙_'+tA?8ߖ9\E\oo0X^o/o '6#s?8ٟH *|X+>mPN&:XhJ[BَNYAy(@hw9"j852RrB8ZӆB*GӆT ;{=N+$Ow'#}}' z#,΅fbG9Ŕܝ6UiBJhE."5o䋯^M\N"+8jgQ83Y)ʨNh2 -qؕ+5s5X39swU̓h+g%v-  eD%N j8'lU\Ursx :Lk|gNqvٝK^#s{@zטU;yND=)9xIJଲ̗[牓d; F:q:Lv0c|^X4_ MIT E?eЛ^s+V7;|9"$d8'Zghi3pCvvV+uz$1X+4y%+KGSNNkO\'-F%ni6 o&^]ǂzl8+k'*##ɜVʭ`v^sh g(, 5pOn6g-1f"{ ZriۼcD+u+S/u2,>#Kٸ6]úxoT mBWФWqb||hęh}F3;J';WM#^k?)/Z\"^?]T z 3<L2~ ;J^ކ;~3|Yxzr/O~z FxST+us :A  Xm`0<9{o%4 pNZ9'Nhz)'2!K?TU}=re!!( C ?ύa s3e5b,C,5\Xk}>K5gĸ,g]!cEŅUXl/f,ve3/qD~b^WvSCb+«ߧN!ߗ\xcʇݏR{.ÃMǐ%~$g5.&^xWUs[ys2 gbw( I$y7Gyʟ`o2-2>}ߖYe)|rV~Spk2ϖYYLŔ&M̧ag篩篩Ks-}86zS35dJ|wHU,YŶ̧o]j-S=ܣ5XCC韣Sy3z͔yz)(K.Z˶"ڞ'7pL~(d|oP7(/r?~)ߣcm2ͱv)Ǚ6M]^]#L3)0ꬦjxW>O Ϟ{KL?Ӷ6ZHoE88$sdMd2WBv;BSX.V,wKGy!兔Ϟgs_cYòy3al6'(໴:7.inے/S~NYvÔY^(_8֋SeL /6wC#n{ou|wk:ש=feܔ97幔W|óMj&sϢ\dy5a+ncIpSw|3Yo1o1g%5W>/^9> Q 2?W"pg}`͹*u#j#Pc?R~%Ke>N \G{ߣ|<{/cA(odgY2} ӗ\jm5r QOeST5OtQfxnmדQݶGʿww@y~y^a2gubC+f[;F/wz{kk뗛W֋|Ec<\=\in47fdd{={,ŲNY.ninZ`33}l/}={.ve{至''p\<.ߥɡԿy<<-Br!e}^ͽwunb=WWe2ϟQ3\=n>C^Žk5꟠ sC==/S6mhnڼtWz Mo6I_L%N8> ->'rOoe圸`^"C g圳}VH'\yZ1b>DrJ ,5_9]'}%w?_y CS?S?SKxkoA}a}]Œ*qH>yygg/M<]}gUפ\_w}]j1}ns])moK6z/lg鳞)}sҏ{~3,}sg *o\̝m̛VbUA0vjX֞c5KnRfQm)"]fV5V%棰jk#[9Ek4nvb~ }-ǯ {_߈ߎߋOOc`kք7^EK6Wg9hs3%*:IDԺXl\JÉh[bib9%VՉ藞ĺNXi'lnQؐ /В ?;cFglU|"/qPk z+q818'ðPxXd;{jGKx;Z0sЂcWLVb O& #M1z hä̦tJyR9)?*HJ]TE Uf(Li!hH$CUTKJSctKP3Օ1R&f Շv`+fqbGJ1KI7⽩]&c"u(5:I NΦΧ. nn#TNrUj}y~yN7̇Mgz!B-gK-$DB""!^2ws/)nN4'Ad*jDZ!>-Z^EXd^طnd~qs',~r;b)9~ry\rq"~~fyV>$UlSDвYrlEnK-[[v<>p)vt830p\~FFM;aˎ%2@ aۦaʏ"< zi,{FVU`SvXN=`38u8pʉπs"23pqx8șG@)(ajP̏Z@sgX3PڟЙAW<=N 62ĻMc`Ļ8gRq\ ܘ ߝo_cK4qMG1i1u'> =%֌r[vy,ŶKl.*mi@^b۷c[&s$Ɩ[nKZlA8dz 9Գ!Ő/Ϯ4m&gVNO A{c} \X_3XiN.jy|-4Zng MO˓`e`j9afiü2fLC^{҈39&0v:M~l} l='{b(T&~&kv O1;6ػg[?M׼ 4۶ͫvnvf޶Qyy6a$ۗ[7YX}ykaca_cUk8~ Nž^JdOV:ϵ<6Ogc[z YٿyyNoToJfXVU`MF փ` v=`?GQpg9p\-p<$I.S/}J\NjPkAuc=v&,;}2nv]6띠 ^G&>rwC48 ΃K*72t_r޻|BQ/\Sh1q/@ݗ?R\x,$Zc89,/Og,n44Wu*&R7ՃauP=TɈzAcMz_}ZBDkU Mi͚e mF&뵍߂M h~vTS]Ѯi-@{{ݯz^z^uMo[tKoS{^}ާow{!>c~Z?/W~[7#Q؂:uBLl<ȕNHA[m&Kj $&\/y\(KWΒR+~%x'ʯJ~T'oJoIS҇Vg}YzW{[zO}ַBj}IR}k|?-}ڷ5=JK|oHZ;/W\3?:*ǥ^vc7dȂ##&۲sv^/f78hLپ*0sij64p9e鹥i>&$0uؙcb-T/cUWՇ{t?Q}LA'׉r4;{zG %ѹNw/hUta!DMS;5ttd" פEˉvz?4~=9LzA|W̅ \q"fG/K/bȇI{WW"c|Կ˿_z=<KjVWkuuA\w0ޭC\{ouڅpqZ:_ hϕ|izG4{ e=E{e?t$VrЪPrBSpE%[\n_V]ŧi/Pُ[| >nK;z>W/E*^/ ͑t);4W{ezB_ѻUM_oԷC. v{l]X;)kZѶhW< DۣvhF‡h x ?_]4_H/!XzǤS|Km +}g>O%zz~޷w8hכˉ)247*R"R#Z)DH{v 7~ ^V{,+9P D6G"#g##"W#8Ӹ-|+r#)r;r-2ѸEB$2*y찡+syJe}RZ;,VZ뗮cHKecVeZYX5Q_N Ꝯ9T)[#nerPݮrX;x^uYWNKa@FMG?AI_l ]j X$O!jG#u-vv]$-Irgt-hq׎Mʮpcvɵ, >yޢ;ᮙ}ĽN)qSFfrHpH>e)7Oнv B㡓a2 ]]B7 ݯz(r8.ةMQ`䦷lWŤvp?v/6 ~F'HR;;= ТP3¢J!^ЊYP#9?bn񗧏vRݝk.r(|9Ȗ-!'"ΑRp XfN>;!9sua>j!"ׅoB~tq;8M%v%.yT5ʗA+O!Cəi3?sR=Id;M3YAVw)gʈNC:93ߝfU^,ߓ$vn<; g7NJ|ȗ+շ86'~W}ʙi3?3C;-ߦ||PQGoϸߕur.?18ou _9\P-k3RuVT*uo[u{~8ȷ8]Rwn](r 'cP] Je+|^@S%` h;e !x;o | pl(p:pR۔&D\//F8[[W?rq>W_8]_SG "}yJ!W3m-X|Cw`a2ν`8Cq/"}~ ܬ`A >NC~C rPհ HkP5(7R@iXV474#zli бa?GQ^p"Co8p&^pΉEņ+ 8p ܅|5z4?(.6ƊZh{ q;`Sc_]`/8pNϷ7U_ovƉ{A x!<0[bW`p0 yqIՐBCl;Apw#A:8$#@V΄׽~Crp ;^|vz(_NS C%܉B C @q*|6h Oo"xXo mCݡБQpEwx{Y8[oPȥN\*@u6 k rSnc:$w ]sp&}`{{ @#:qCp N]΃K,s):{oGr#yّb0EQ΋TFj"vL3-`d)XՌ:J><:op,V#ТRf|؉yya#nÑp GF)G"7#w}'i |P)Q!+UX8)7(44() `Xn +eRަT(߈B|F9\gsʸrK DjW=j"qZjՃuh(wrZT i5 ZՐE@ڎrŸGE 􉟼&d::  !4yrWo k:y\-AȳA1Z%ی0Ŏ,h ԑ;W`O|;!v},8AG>Na0.8.kژv3m@ ,BPυ\UB=[{gzV-gžk/`{_?ԝtUՕ^RALwbH`Rj)2H)UFT)ER"E)"EAH3 ")uR"4s.]v͚ߚ5>s}f_j:^I}"CH&iC^jT}v }{4ݧɸ"z?JIq:+rDhJY~o6*| ;$꡻+C =*t|gNa uCPҔJy˖7N9rmjy[Q2ysVy˦saW̒鼨󶿼Oq#]MN_,{? .⃋tޣ7}{AzO_tR[cG}w7bzo?NҏWkNw9SQ^YQ evMev-kImP[%TR;@7^;RhLI}'N^{g,.Z"\hnJB6nV -W<]{@j:-t6ڣuPTPBRW9BrY]u]mr"#FT7_Z7_uduu3fGyu  -[Q7nEH{P>nԺ&k[]խ$T]򎺝r#O`E6"?\1MJS^ (b\;$CԶ՝k1z2bMռ Y\syG*GB=*yJ *r~6b\;RO U"Sۢ7\pب|5/m~zjиYrUhЌ-9ZXqH-շiU,/Lm^M~jNMOs4_MЮԜԪVIpSV ='|wsjHm<*KTkH"}Rj ]^&Uw|#H)$寒JCS*W[eRgRbKz­wOw//UIPP?X#IS(uAl4DWP薧~<* ?Rw٦vLCNYHxuAYh{ͮr#O`jéBumŸH%V۴v&mO!db[ LS&rw,.Y|#GB=RNjMU _(%V۴ARt+%D&;"1K\󝗝JHMBӄfxn-2GB eF˽QC#!~eBsm՛"ӹLl|euZ$~y~urMX;"(ַB{?PzwtDbl}XoiTĆKX_\KkMNޗϰP~W i(s BB:wLjKTvuB C7%Ta,u[GOe-k 4YhHqnϬ>.t:^LgG6$&^LGIh5 kY&\Dլj'@hqͪ򜆥B+Gu\O54 )hX/MAm oFGkh1yAm Tj'M-rmAS95V/yzrU] 44 Im"MV"uAft4ǸsvIu4}B*)Ҧ44O~yↃBڄN x>0ާ]%]%]%ݦWعr7<5HwUUV=3uA7mbyM5&fSsovg}hDI23k'CJ#_rmHC $;ȋ<Ԧ||:ðkDE*2GDr1Dq;"HBZުjcY9],gk[_O ;>5JLjjy~h@Q\"AĪpVEDU?@nD*EgeyH0\шP#35FXGyZq ~?kI}\y'Mj6vW>9#~R$|\a F;?7|Q{F%^WFЌPΥΕRޜCg9Zk;Rx5Tvs|jPfiV pHi9k;95DބGm9rĎY*:a1:1A[Hk(zՌW+uoCxOJd>L}rTM1kRx>G A3qo5ZPOsƆ_m5\ )Q+ԈeujN;*Ϡي!Gw!/A6#9 D󤢬hxmFGЊ7!8~.^-/2H U?BE4/baht&OZ g^枨l?hӊCR7䗀cќ؁vϧ =SyY7N!$7ٝ\謈KS?s0Z@leSvv /:a2OzE^AV9#}~JֆO?4^mVk[O[HoCӨ0O"_MG>$ȮoOk J.Zgt/H=Lj?%VweՑB=ZgM+ke#k΋TnvV+h鋴Tm>G_%ҫ3)1FE3]xb+.*VeԤ }3Bm'^ 31YG0scc4ڕz.}vmOF4E>6.eg`6w-}\ v`y05X.6NGRQ:쳉, _&*gnlu+@sT=LO){TDӿ 4xA"Lc6❍ug.fG;ƫ1lt:Ƣsmql9[.*g#rl8%Ƈl8{1ޢnDtl7-f#]hm6vfccl 6}-f#FYբj6F5ANxi6 }eٸhQD4 "6YF;#Ιpfc٨f6afٸe6bRfd6&Y!#=fxc6XcFQp1K,"faCl0Eˆ f~El/"#L]6^ect\6.W\٤[6򖍹E"Ζe#iZ6zV7F"e#`W6ꕍwe#]W6kecY(V6~\Ŭl *}*;Eĩ((HwHR6vE()ƈCQ7ƂQl(D')d:8IDrb8ml(JL6&h0Qz{F]f#KETbl%?FN1hI6 F"٘6l#FEyo?|6\O!"y?+@~k]@0NtnkO`_RHʯSNMjTƈEXۊaGSQLfkۥKW=oFވ|Zz|OW>+/? ݇i;x||C"WR6ŧ?dݧ|%yo?dR#Y' ouy 8Y=D>dU61܎YWӺ $Os`DYǑf Vrԛ_H;sཔq4,լ@~>+/&c ;ggzo`'!X W_ 7i #׵Թ:ObJk l'r۬g7b 5WaS0rwQy߰@3v MM^5C8 间>V •h7Mϧ?͗ Nwot?oRHxWr|̾iy.gw=ȩ.<'Kv/@ދu qQg@;sZ92OEȌ-FC?9oD x M{&9'!u wN)È7@;t&^K -r> 2x&?a3_Fw/p?e|zZ1@J" y< ڑz |ĚafCp6i}E įL/9r323x`>ckNg5t횃i.<i:?? raߡEn 댻 9İ8BNgϒK6ccr˜ ^M{Lj;|0w!*ѥuVYb8|wp HX\FVyۤ~9r"ɞƍHX+\c.NRiؓI{ꈷxZmeSY: >bOs.&j7Co>>;w#g5Ӕwm߮E$>)ga9z;:Jsg#^Ʈ_O=zUfez ט)D$.;Hb\y=<~a %7X{Y:kXvM-]r=rƿ$GQ-y||,%׏сWg}ٖ ` 8]铤&mGP=-OȉSM߂>#W/]$ɨ->]brln'Rbg3ψx?!뺌nil4m+,p0,@sU㟱Kb9>HQ(<*ؘ^W%DŽ80^}fz.xNoFR\9ξs n]p9TQGJV "$\^J7-r~xI7 ~grpXLtcX6_>> Qr>R'/?m+k{Q^3U]e4QoB2|Kiʍ;?b+yWbGK$،իCo3^S?%q_O n7V_'RbOj򲢞Jk` LDu]v'USP̌~ӕ}*J\+su'jM Կ[7;~__qqqx5y,M؟|@o# M*=3ιYbz'|}ޫ{牘̅>ˑ;|z;BRݠ{W>˸YB:{?K%"9mA{waa$yt%9?E20|)AzNgt iS٪r=tI͘sR||Ye]7^œe\pH=[/O| ~VxRMS{댾"oC3.aE ,߄D?W],V>~~̚]{/ B& W}:;N!5dVJ?š'Ӻ}kPiZ>AZ{2}'5`-O9_dYy_Gfw}2M<Nłs'ݹҒ̿]6<{rw];S|My-mϑڪSamH‰̑;/_U.~&܀BOIj)HU%>+!gW~䥟V.OM (t ^/ꥷe?|]GB&ˑ􇯀+ς|C=0j{j3]k 54+\"yovIW{>F|.o{ hI]>KH~ei) ՞*[{x˔DoA]x3 3%,}ubǛ c8Ov>RG~zoKՂo!k.'EW5J=Qg~t+nm>M6Y9p>ugw?璜Kɹ" 59)C96]rhrr^yLܢb3on)Ƚ6w)̽1w)ʽ;S4LGs3AsךܧsכܗsWr_5չ}\v;6&|SJd$1Oܘ JKdI4&͵$b$x0XXe>x:x>dċfD⧉mS'ZͧnO% ?щfLއ>lnh^WWh՘F]oݖE3!12w_<35;yKʹyQqӨjWf9VzPhʬ]dFJ֙bv s3Ḳ7$N4q3w&9Sdx3K8%rgYlt6ޱvs9v:ed]+N-k Q&̲!eޗ*I^٭e&dL lNJʮh|Vd/)']Y㖶^fd+m+mWI^,JzW|䟕lqX"kܵ/l旫9z!jɻZp]rd/%.Q@/)^.וŢ)Eo֬p { w΅åႚ>^{T)0(^](X-ANR }A)KF{gDTifcf@DlQP6 E܍\*q}JJT⊊]xUՌrO򿗼ʩ>[:gA R,^0ԙ`h]f{aј=ӿ1I&Vόٿ-IyH`\B:.eΐ2%oK #iY(Y_\U;)EIMwa&Y;|. o0_+cXw6bSL[̾x)%ri\=JݤR-,iƅeU-Da!r -aaILC@D7~V$RNH@:Zg `ijie!* P0'Fj"!+XR{!&Z k` Y5İCiVđ6P4"`QгH"@ y:YbR;nVgyK0Q7B V@]e7؊RC+3ŖDeَAjX<ʠ\#Q5?(i4 tb2/\j~O'ZMRٺF}S/S_sR{t1>oAy9\L*<)d;Htvl11:89_7J Y{:8p>f%ʨٴ6:8r^oJ'4: ߙgM'?@l?a89)v6Q6uOAy9 _H*J__;)E9!\1IT?MS<êdX-/`X;Mfl {n2BK}A4itT^XYllP#xxX/_UD>"Jbn| 6VI:*J05/v"cxxVS.1Ji`gb\Ji.$Ø9$qҀ7gi֋`\a42i`tRXuiE0Y) ̌0VJ88DBcҴIaƤ1C #%H:j6Hر̱h䊔 q0  $~cm 1E`X+5FqCb@Rfjx  nHs58Cc/eVʱHN86`R` 9z+|AZu > >oHV0# =IG0|iiV2wu:FcӕUnDЕZ)5Dt tO$!^]Rbn tVJUpD4+*I*O]R$MwJ+.J'˵Re }ˁ)@PE6A@Ju*PiR"$N'T^DH1HkU*BiO>ThÔoR"\'WԽPT.D,Hnk˔gt33$"2[mRfΨLA;J)V9|gSG$NVV顽A{J)=@[~4rrwjkXOh ӍIsbbCb0i+`4e2E"[+pI0lX>JJ xP Fg22~|> a= ڟl.gܚk*16CDoMKj~5p,l;kOI*p}`Ur\uRXu@5ސjt_XVjծSm F;?n/~_ů9w?.\_K|9 PX'[N*'-\mL,XXW1 u BP350(L]•qT)^f&QLϘ-EE["b(=EIWm5|-6Ӆw2]y%txӓwML 0/߀dyof 1f?3od"aԖ;a|g>w3#YW?}q9;>kR jkh4!p 4H$hi&kR M9BM&&M6]#SpEȃT3b 9пS*DpdXNg8,Sc chh*+Zhh cc#SGKћqPD*o3*_Q ^8g472N73Zދbt&|S73|+c3߉ĸ]@ƕ¸{Dΐ]wc$ o13MdԭW^U׾xqy4R|j׉JvwF}P=UvOVQS.nJW ꍚQˁ*V۫J ysQnnT:X:V|cǩꩪ}".Mgbe P;f3%tpWx5eN,nwbw K!&aҟ*H +IAtpHcWzaYRܯ5K|}-8)>C@l7T)~Bm:cPi1^G4d!/;I wzwZD~ê|ҳ~6@e?Ӊ2QcRڕ{[z(on,׬Y;m@I|6S1x%N/`J8aNʣDO$z\@9?7e{]lT ڙhh.a@/!Z!=& s*=x 7}"6 p2qz/4XM++ϔ~ri5RD@u,kPq?w x &i?SVerU*Awq'=w8NѸf[p0I|!>A F aaLJf5/]'H":K9! op-{& Hg*\*<#!A:{, ]&G'y<9r؆'}E;1Ѭ($i"M'a(|O1L'|*,qN\ύOZNfS8I}zwè *?J9)51O2P0" !;z pDaD/ny ]T[X&F%劧HdXg)!-E:JZrj-[MJ%V't)W@RWJHѪR.5 ;b,*MaOks}Igqz|E4·>l+F@H3j8^ :_t-ա7>ݨ>9X-*VU݈mA*Ҏu!QTZ*k [Ɔ%@t a;]K0k1͎w #rи5a?sY{ԳS?\c"Ioʆi+lSI@vJQh!ЋT/o=vߚܝE9l i?a%^Clj|##CŨ>KX"M >6-q|:ӗB}xG#KP)Fñ'ێޜ `\IrmlPW?E1@c褡&7G4%ͫҩK|0r~/@A{^zcHc5WH줚w7B Df&*Sꇺ$:#MsW:gq՛C^Z#`Rt{?I|wZ/i \ i $84tѨ9ÛsNHdkQ?T#G6smGZڑzx =Ho-m)whA>id꩞C5'~?g3 ߒᝄbaZus*c%peMʦ^EѕKHiU@.9#f*Eb8ak-D4@XCԖTOġDga4Lq w3pz"Z "%>%+c*3BaǬY/kIl`0%)ԐX%RIJ3V" z q0CD1L6ZfRm%mQ}LYfE+>ZHR+aY%FRݛ=enuP >V"zjr}r%'[)[]c4:ALMHtԨQFA;LjcF$:NL84i0n4y&!\^] H{l Bwkfγ:OJJhѸqdb({=qm8:jldҘ^#Ez0*@E‡)"0H&ZvVƏ[D'NI[Oj/YlAr8JlvyuS6O>']9^Sg3¾7j9#ulS1?p̌E/&.on7vG ^Lve^l=vFY/HYSlb_R/ٖVvK@'Ru̩xR_k9ӵ}K&xǟr疇|oyzWNdz x[r=R~t6(ܹkkÆ:t+|Y.nkGz9:|zO|ko>$TgKaK]:(]eFN:\6צsuaF&ݟcxx?xú.y_|F_o[卖35]ae'OjZ vBIT&ppfy~Ӱ0ԑJa5ZFBLӄ_LSNҮow)yܲ ]ڿ$k]dп}x8Lq]̍_ nz&E1$~'BhU3BЩ9ClGG1?i ;9{=$;>dr#X`T~w&e~v;3 Y/(k)y|";/o=䩼L/ޕ$UC|#_|0ӽk?q|S6ZynXÄ֕37N ]X~??ݤ G>4fIC͏?hT Vշ1==sV~ᆬe7bmĈO֯l'889?qeSڒd\nj YـCwvvmi֨Aڳk,悎>8<0"iAn[l3?YPh<埍=euEoiq9 +x]mFpYڐOXX}0o1a:WGEBG \(|ooqbGh-Nl}> gߘVs;4ʙןN/ ]Ts.雰v<8w?-1GG]f2b /5{$NmV{[Nxb?aѳ$g?0AgW߳'vO^iBZFi$;UlhXVgnwɋ>w\nax<&˥.v׿iJJ۫ +Pg޴-tرν~S m.ߞ~~M?5lÏK Yi{b.k6$cdq&ZgmAOhp_ܭ`A!u0Mw'LW}FMȦ<5GgDPO?_?h?&Q͎MӬe-yc٥71 `Q `DB3Oj j`SD`[ϛBlg9xqyq[91W-Vc{Ǿ9rٵMnSj--~Toč]B;>{\'ti)Y}erޣo8GˏI4ٗԻʻE^٠~WikWXGci쵢k-rޤpxitNgFwTq~zQvFˈN'\yRKs}ݶ␚^}obywM_rƘ+Mf{9ogϽq͒. l)ƞ)քilo2'x>³N!o+Ly׿FƵEiqxH} [?yRy^I-ygy6hxD6 )Ske@! -eLی_?|)롚jRl& )vZ!׾`h\YG k Isq%єn: o^_oKqw7t# m_+zƟ<(Y+y$*?̭5!j%C\vA7VktrǕ s&yC1J}Bouaw}nQZ \-3Ut]%i-=s|OkSn];_}47wy|V%Y_\^rtه ݿɯ_oEnM/Lޙwټ5ls-Ϲ]ۄۯ+WO_riwbnfS_;}XwOy%O&NxрN?9wme= /Q~ʍ}|I.?~kJM vo^D]Sj<u}QE<~kfjc㤥/_%)?4MOԫs4?_{( 3nEs|XP=7D=o:#Xю e2LG/JKlzuV% p?w' 3GfY]G?w _-|<`w9A՜]K:$L_7I//8' műG?Q#@F8!2aQBd`hf3c3 +&wc$/Σ e2t7&h~(JfYYsY[_uX6p}^ڼ:Gږ×ϖG5F>==o%1C֮{mю@ Bu_ӱRȜ)3#/l4}Ӹl^&_uySŇc&MoOb g?}&O87C A#Ū\8$Ža~N.j[9ܬA¼Ug X64abd4h:>!bdAPMĜ̆<31@W x܆|Ȳ,MA7_XO,^~9$-)ϲw.'}EJWgn}K\I͗_OAX{r%_yqjْ_oRҟ 0O[Ƨ4φF_|?;2ͻS/%KhʫV9?{1.X~,+u^~Ufz9)w٩V{9.v.ȠnR ͷ,+|I7ϴʭf$7s9qw endstream endobj 301 0 obj <> stream x]݊0sٽ(kmv&c7 ~'i>Μ$cNC<ݬ@UicJ{"2wpl0V9]EVU #nA$7oۺ+7q^ BÈIlzWdELDd?.lA|Ƴx4hɉy t:zyi_c t:lkiqoVew\P 3ϲ$}}NZ#_Lƻ Ke\ endstream endobj 302 0 obj <> stream x} |T}f_f&d,$$@N h(D\A\qAR[D[Dk]MWjZa罙 -y{ι瞻{_3Q! $7w~%x!ōg>rJ=tvS}oRKfFͻlF_?!=Y!?ztpO!4 !(zip͆՝ 2wǂ(ȫ! Ck'A5иf?p&BgЬ{f-H"2k.߾ sD$d)ѱ}ٺZFKM|Ho= QCJ_ua=A;^Zնsem Yreh9 %yXS8#HPHD`)9wm*%'>'% R ƏlwDHd%0 mMgˑ `=<>|kaPeڷPXx} ׂP@ƫP@@p(kCWt.^xB9u\C0ʇk*_aؿħg[|`C ] $CJ< xw;;S7>}Y?_ʾ}9OօӫМzs֜:_L/ 0|wýxuݞ o]RLw 7~v9%fMF^5ϱ )EIK=j^ȓ2eyV?'Oʙ!yjZ £3Í4\\`ϝ'Y`Mrim4M"5/(,nũs&q' ϾޏۧzMYTuy PTuy JTT=Uo8DơI**5+rv7$ڐ j )~`laO'nH6=040~j] I\d]hʄ ~}`u)~R͙IQZGpo̪Ii$pwfo*Ua/To$_߿nrLMIz&eIE8ΖϮc5D5W?TqJDS}4KÁC~5譂0-a2( 饐-b( WNfik:!P1.g]O;?o?HIorooop`pc^q2)GzI5k9y9ܯ_0dឥa➦b2OOG2p?aaH/J`~A^>^|7CGn.NnsN6z'dnwpcna[-ۥu췸koWqWW2WWp3WIIA _]|_V,|w&}{:> m739))I Fn=N):!I#(=®kQܑ(vr!z53qh[E+q)I=x)^R!ݸ / &͓J\-\+6sML3ۈzH:f;IOgf\ SPT!%$gl+clK2Gb\!]0dBl32`}R;9dD;Xgm3mb1zVˉpaycxUgvǝvs젨<;u^o PcV>Q /_4I?ay9|~%Lct P#H'[/ RDӀۂ:B Dhѩ, ]R-2# @JWv3hʠ#h#:N碋"烼 Ղ~#Gvx/)GZA GTzΩkEN]FO?5y?6UTUBB(KZBi *B13 ^8A= ZҪ} .)P Uͨd Ac:uu=:mB6@;罢=a F@ ph_jHHǙy:ՑLyv!H UTgC A~VZ E ݡRҚ&(;of'ݩc"QTl8j"7P0ߖRrj̚w/0?}H`g\8TTYTU6+o3*7]uq@K_>Ɨ3ֽԐSW#FD# I8QlctG)#~Y>]8>~|Fp*5>K w!_Vؠ~g7Iy p "Ufi"UUm*Rt3ZTb#g؍:gp]X#j+9cYۍoY]3(Sy{>Nv\Su ~'hu8% o4kZw4YIc ^Ի5X{E# F!ڣ5F0UI+Yc񾌗Xxnqrtb#neuqe6^Єk kuvj1ڱJ2NՇ(VLaߙXgLR(8b:2~?r,TS00fcS 2; *uƀ>/6谈5:d_k Ck),ךy !-]o8c.HL\vl*-MNΦЎfR/EZ؜`гaOXn*ѶTkjAdYb`L  π^* iT7&)eBDc*< zV+(!fNcwNuڋ:e\b(htXNS+,q_A_DeX6y]cLh)-iM3``tz18=^MO^s[`c b-6e`(lJ`s:"`j@%bJ\eR& o`lT.+|Xf*XaJDZXYuT5)%DB颐ڏ* :ʮl9e Z,mEZCKʮZ o45>aelv( ^kZ߼B&[w Rk Xhu鵞h5lEM$%Sɟ쟮_b[QV&ODLi66zxWAY06ﻅ%FtkNQgMQJ#Dm~%I6clxE'0V 5muhmI(xh8;)洬s,G񷋦mxBp^KZ E]蝹:- Oѯd gp>ug6m)7k=!,u QV&`$`*{YV'9e.>Uؔ" 3KًX#){*ɦǹr`nVN0kM<[2.}sf:l`z^ 8)WbFhf ^Pfqf_UԺD$]U=[4QF[hc&^[Cᝣ4-g/.~I0X+ʫ 5?aX,;"Z.]NFҒ(9~#KbDH9mAE;|E 0< -=rbl,.gn]痷2V\pέrXoҗU|.x) Moaթg?E+ç#ʘb8+~JzSCVMU$aRzRmpi[+ 82f^֋gȣ6dr^OH/ⲧDdED@bZ AU#J'hlxlW50&h1vuOo:XDf1z kr҂efHXQl2EzzDN:Hk("c aZ+Zԣ>46ya^NjYD] '"45DvAe[-_ RIll`a\B78#gm!%^+VN0OmUⲲU+JΝiu~J !!0sVv$eSҹV vHtJPY>3EBj&QU&`5-͎x !^2ZK"+}FUv̎׺Q.4un;t W'^hKih7%N8"9@`JKƆӦ ܌"k7F16񉎸c e959XM&c*˪uZ5lºyoH¬E^(.:WN8kKz՛+}-> 4FDe8d!lͼE;erճ.,N13^nVsq_c &g)|Yi3-kYMi};׻fPw b%"ounvdf.BáȥS.a7&c}Q]0ޭcVcö;vPuؔ2'FweE;4:v۲߄]ʈfyhO٥*Q; O=RR/ʫ ũ#ʶSU(X]5Joh=P4N)HvEn S;S+ARTQS@zJ=v6mT93ʬw+%d`/ȱQJFZ]P(V/MӅQLM6abZ9fSxpYgV z_qi °͢[p!#Y :6YoZe)x hk3I֤s9i[JsE}0 ZSoou [5 nor{ӽ™`r@uSQh9Mⓥ^A0H& мʛRzacxs3^=՘dS̤DV&=gW;)J,kK0Z2ZX!#j>Sh՗B#DC3 "D!B"t w" DI+@ky"D+qO"D!B"D?g0С%"B"D!B"D!B"D!B!䤊f4! Cɣi4s ]4wGh w3z ͧ12`C>M#':,4wGW҂̓GpG> ӎ|z}Hȴ߾.ʧyTOW5nKdMM2iQi(np1r r@к5#䦑1\֬U U]=3V}T>36 OeV ͌5.{+Y40x̚~ݭKƇGD 54614@2*FIL(OMCQ6V꯻.(`i  WkVZ通VAZj5ȇq57xV{Ԛ0(~3jylAzתT#h?%@olQ@07Nr@l8ۙ].ʶggg۲Y!۔dY9ϧYeAo:([C: 6d[ζ6l/pz `# 54g ܥZ]p-.y/v8ktQSペK,\A 6$10NՃt7 b-zX~} *+ڇ/оCc_ 8>} PץC >N"ZD e #rTS|Yfs_~?c+E!Lu)PR6SQ~*@ɔD9)yqOxL|Ĥ9_-=v6+?|py׫_{j|{rLu5)MƵZ6yſ$9JM;xWWO'~¿|˴ٲ鉚B{`lc̄<411:^{ǡpyhFq4LFJa'6S͔_ě) ݳ1so3/fp=^r!:=7ßO_y_Ͼ<rqϮk_|luɝ]q?w[/&ߥv\^Psw'߾q˶s/ӳ}m˿:77 7^븳qƁmy71Sr偊M~RzN>m-?杷zmow~{MBɫ,VVܱmyIu)]iWbzNβA^ HpcJ4+IPYwzu-N& cNX+.!NVa=bvEϽW`\Sw v_[O D9;Sk۹uC/bKd rN/*YQ뻮xf@.-7!vFzBn-Oޜ`Xfbxd]2#c&FƆ'6䷦d2ίT"H泇/Z}m;=W]z7~<ÚJ8 H@:R%J&P$  ((]AD( (PTVҔť@`o>3{3sv){[qY:==ᡵ綩OTEd'dDߪ{b @O紵lWūlWe^+{iqE@C^ٳz1jDn~ GA|츚(ᴷvBY=7铰_ZfU-6ٌpK9A3= ]~)<]&x<|1>{'>C*lAW Oz+ %4Iˀ α~("!H8/K+le&-?8kSCF vzhG2:fgk;t뻔o",)uvD|I' Rm%-_m:pd4ᣊoH2uc9T5oG^97h̪#*Rda%«]~~<ۢ݁T[ W^μ?Ó[y=ᲨE@w6}j"\(د b ᢍ 㥧#m!R)Y;E :AmGmʵ<'tq^Y  O^&PA%#;bD!NGs?sVs:Ev|fer_) G| Nط#@&Є(^K4[/otGhpZEUb/Wkp6!V >xiwF"#K%̌'r fJz4=z=Mi$K:GYyOu_Ó|gmKUUюnnio,}PVM˽PK9p_$η}l|\tf}NxGu6=Yo:tESV}IՖRIys^ > O[Izuw=3"#=R\VHNG8NdƩ44hnZx9҅!1bB"HaiU*{tՄr6tr J)=Hztژ`UJ7| u|j#HPE,:plq{|J!ŵyqkGnC1Wd˅4tax=+%_l~Z.`9 ;&@#7a+6$6̩PیFi05[jYpifʢ[|c(~Kr{ڕ .mؠ՛D9.Rk磒eYz6J`RZ ],*<~l+܄B~QT1F VJV Stj+t>AH(#h`2]Ò3U90Eɸ)wXFd^=^MJXOw>Mp pO^D]yiqb` h{FM6qudl-/t>I5Y$3^.~FI4UBGd܌X3rtN'Xiq] 9MVy"fzA!7Mik~gܛ/jXP9Dm;rj;O-^2Y*\'ג²j◜wk~󳙳5TtyUƷ]Ayނ^y6Uj_jT(?q!CEA 3\0xS-JD?Le(\9I?*808/-JK[ 7"0A%$q6~0G37S·l<bqW֣pR1GSB<)*Яrs n|{*n'0QEs mF-vM9S7B9eOd7Tl{ߚyE #Nbev^8u;Lq?iR?]2uK.?sYmOUoGUJt?3z[`jNNqw|1bX5t ;cufoXu>3[> stream x}{\\յ<}=000axÐ ! ByG!hj}ocklmZM>jV}$_g9k}{~|zLt6Lx/_0׸uySwZH.Y-7ʵ[?;бe_^{-+`C>vص?|@wo?~l߲kl98g{#o =/A܃Y&}/ _mWFl[= ­;%t7Yޯs ԇ}wLmu8 { ]-_2wW7S)|ia.5 9yj޳o%LBGӞ)(*\*\. pP$rCXGmRG]/^rPqw '"1-3Oki&cp XN̍A=%{e;W>Sj0 9>S #`zya1멏>$}d2?6u u豚 6噽/ Q IgMb3INfN&KdZ3Ě dI` l l&)I,McQdlIæQLRjⲬ%BbӠ46ugᑌ(oddm| ' isLMM=6ЃOzTd &Uf^Yg pxi66Z :^0סYgq`1lJ3LIJҧ"a6]:L M` `F x8m,M΢kQIȁP4M4?h $2f.Vй[@tZ2-Dl*f#(M#60"6M3{ѡGb0Hy|eo`f+bӊzЄ `6g^æu!Mb3INn`e0hɴPbJ`nCOi}$،heYbm 擔OEaɂ&B찣-3{3l#]æNbiIp,p9(`2%BX6 8kMdًAgd1N3T^fm)IITq1lE.YK VllًQgbq䲠Jd`>IITzsx. ,-ⴁ͛jaqŤ78^JQTFy$韏i)RPڱشboXINZ6  l_tF6ʀZdZtN_:8msbh3lh~$%SQ^Џ\d3[KiyX`:RgfXIw:QaZyNi Qo?+Лr%B3R!bTHwt?jQZ&X퐤$](d2 ]nL 3HT>of/TgSq2l椢J,;3I?GfltFHI[Kِ̀Y}<Ȁ~ƕ򺬞4yiRm}$)IJUBU~lf/PA(cVQhf7?p&Igy. ]ѨL A]\W PƖ/F5ZS8wf/J7{q @Vz3I?!tJ3x4əcIȹ_(V;LYZV^1M 6/XҲt|Y~zaS?^2bP .hW)f>4+hR14V@RM8`}C|A !e7t[5{H~[\`]֪1u6[ۂx7]vv=@/8M$bMQe`4,}ꬄ>(7?_Ǒ4%0!\2]J[b![ ߜ/鞖΂ ߟ)x^À47 GV=E7 ZڰQ{U<`w k!>-5P8boμq`oμ9ۼ+@vnq9t(.{Æ8q׽x0Gy!{-=x75x`c85=:5&WGLitɛqku$$nyi{Dj Fitdcozw,FzY=Wk4ub^yaV-02cվ5ËY7J9G{0KS[R}lW}/yaĚ'gRɏG#@!̑oڑGK|Z+1䗑O#`p0DjW8~ ' PhyFS5(݉|Z =f?ziei."#CGG^>rG#G#-G0]GA>:ǯ>e_>=}RBi4߀9\R>=2WSc/;y1D&oW _(=q1|`*Iy9xwcocGr[wAa^q#W9J3U[oۓ؉=V7\,5,2L놆 <,t   ~#[2gBgl󷰏xda9(ڤl:Yk$l.(1^S˰&VQ) ~蓢<_E{į')QKD4}2< #>ejW(6}~} ؈f&VG1ۚ6$l]"KMdDJdDfMdDfHdb"y i"FF~"ߎ| Nm[7"A@nݔ'u%DIdDfIdD&$2N b~!?bΪՓ !5ZUUi[]Ѐ4VTXʒ3e!ɩGv&+Y6zYE 2Zh^]O 6?&~,I(k^!&4ou"8.oΥWkS\}gƀȈ> Fj+<0앙3ӯ<x$ORPl0\ vhe큰2پ#d%#b_;в+vlc Y&dĹ ݰ!ތAxz\;kwTnBp3> Ș/~r'ޟ7Mfcq;Im|F{b%jȅx>2R28Ht0PQP Qv ܍[`os.Fa6aA.#$I)Ƹ>D8B#*Іqհ^"sȇF6V:'$!a=sMtA/p/<ljH W!t7=̉.C!G*Љ6l}/g ;~ruзi]>/+ ~bP ЌqJ:p`3] ;a\m8a+ry>{0SKI&r9F~E!t5]O/wЇ(}rQ[zxRjzj}MG@ -pspU*Vn8]3ڨ1(|3x&GIrI5% j%C6_E'7;=d݋yBQ#f:^he_AQ;^MZdRJҊ.DmQjG=@ x6ޤ!Tǽ"oƳ~S㈏Ѐu!>i!7  Z=Ҿٯrhނ=[~=AFo)oAM EEր5;` Hǰk~N^pyj1r0J[<3XV\dp~%'pN2xcr#U N-'] Ǹ ݝV͎2ڕRSUxZ'?Oឥo=Gɭx =rjr %w \']kTZTKhm1emE+537w8-zޞ^2uW&ˉ9*K MleUz!$Q[MWVe7e?l)/^Z$ֲnhZ luv%S^"^焲RI!@,e/d/Zn2"@rrqGre)3T]ʐW^PxE='čh@6щzZ,j1Q3qf-xdLa̾ t; :q.+ 3m#R۽jENh߲])='q;m¦U >,9ulr0%Z}17Ѿ:d+&b\j ϫW=ʚWv w7n^&zO*/݅*q5b2TEKJ+rjko H>)Y+D%_V-{?[>VՔa+GE1i2js:Q]zaډOz0ŌJ%zj|/kORtKn!Q0,speEh!9.L\_v%`i\EwyPL/ S__IiP)j,-v-&SPҴo5%dG|.b<>ྃ;nF8,G譿WD@ID2\ۈw}Cב%[^C) 6Nvj G 7Ϋk͵9#B5^iN gd4Sԙp1Y9%?U ?0\mmZ^6ZFgC=K,VqV]X,Re*J,n CD;ۧc ٢㚛9??JZԾT_6~#?sy;Uo*&O/F3RɉFn#c)eܥy\iTV(r+~bP쁘XteERWW'Jk\\v 3f*4G/v;R_W_g`^}%{ 7-]߲ƵUlvvGss_s};4( - \C*'ǵwW]) <˯l/l/Z/;..$yr>׷&%-7,)-mgڿIi5Tz鋥 2s(LFI|g3m֥l]ʵ~k !kpа[`Y#FWNEǠ kl/ẻI9IqEˎI mg'C+k>Rf7=Q&f3hvŽa^VJ!*J5UHK閬ZHYw-UsBs~Sޞ]ˠb9JM,Vso4pO˦"4 76tlVЋ!5͔&I~H=v:"UJV)]?{ًͼ›tQ@WBI$(tU(2L_PtNQ0$'RDBNl?;>qb}-%[M^ b?pbF^ƹsuQl%zYWi C#؜mmKa̝*jg[gquat+j2yqcv$\%,j3\Yi5 A#1K! KVxIu?mI_pi߈3&yvs}+o=v翻xZ}[Q+u؆^H_pǡ7eݕ$ [Nekl}#o6eÛ:{E˕Ku%Y-ٖ,ˋxab $@bB(B KKmJ4tfe2.I47)7L$^$YҽҽZ{#).n$ nb?EY++[,>OH |W}7|o\~{6NӗƖΪJejωTs[)p\*(@92 h.Q! OetY )3Ɏ)ׁN7V+\;Zu{M'~lwƛ]=?`cONqj4J4 $Ron<lfNoKl6|aH]fOxdIߑiYYkq `%qgrǮm]ۦ]ڶnnc\"mb 8xhlH:#'/OǓB*w 6ZYv:t&X*NgS;Upa(@ī@h" pn61&PBp _UY2?mUn;bBfPPqFe2R m2h3!O@!B>(y/dP$&& PiFyƐƪP@cLsL֋L_|A0AV_PU'!%~r&+a@IJ`r:" 鋲uǀ irȨpQQ,N:Ϊ;r:N=ejhJ 9Ah_٪4SK5o/fGWm+A6' ]Ix{Q0!\+tG_R33 AJ0ͽ4e ϟy2n" jfuf`֊0P ,痱<+&"s6'[9d.YI_ELz {&-tY"!hx t C]#E9oɓ46}CwSv!xk"; LuS@H?V~C++5TpZ1xP tjMJd59:B ҐȟŪ [(r7@xSgun4k)Z7V焃a{o4CAOy/X%0 ' 뮲n3Թh`de*g<e$-WI{_yȡH'ܞƞ30ԞP$!0$8%wHBlMhqB/ߕ7zt!^v4xpC6%&ZҌPcZ[:ƬFwsYZs<+34Uc)Ó ֒B.g +1J%YПDEGhBOgibh5M*"gЉtTJo-mKqJhiB4͑_ xa!L 5  n^m6eQC7y7lzI4ݳoIJڝvK-+%xM4#JdZ~y{w9dp6ܸ)k*ۧwNeżgy޸Ż;=e^qDFRi\87F=k0`hNᔵd6omO(u_U"R4PHY$_6;_B'+W`EEH_JdX  ǘtV=?$y!jK X2r:n%"@~\?M(}H% g+'r8a Q=hB[:2:e79tӯMI$\jLDMY(Yw|7qk6!T>RlR q)Z/#3U6*;V%!NJHMza&(蹌E@T# ԢJSl3,K_raꁨ D_(8g֔ Xe`Zi2Cl}><w dA"/kkq`'r$@@KEXrmk`x *矪:(Khcu4)3T*vGoi62WŦNf+N? XH~ g);5 MC5>c9tPRzl{2YHV[]}/n$%ٌ!T66I\Fo@ ɡHnQVkuuuGϻ)n!ԇg,;"Bt` nW,S-'Hs\=]=xOS R!E # "ŭhUCRTX톖-K*^*]lUdC% F@1ЍWX)OGt>+JP"IF:jn}$oj>Rl2I)/] OZ|Rm&uYSc*8ѸQъr1vHy=%3mf.pW ͒,c)7̸=FG߿?ZjFKϭXB%qGDmK6!dQDՋ&h_WkH9 4jm&wGFG 8XALlpؒ_We πYadoj8ݍ *l,Ĵ1è$RP&bP2L]C*liyO3jo@ [Tk3&TƥX7 5\o d0U|] ,xȡ| M=%O}KzGxpFkm~pec|!I#whzC9B$ ' D {jy{JMeeR,e#jkE<O @QC,E;\T":*]2ǂkvž.av4DvC-#}eg嫕W+J9#eLYZXfq]&86ϥzVK,R.NaOΘZO-2*kԚ"Pgd<w'KGs3&^RGp:B۸@硶x|Z_ɸHSS}ee[z7W.`fq5u+_̯o[؏F _,|JC`#+WჃ}6@ /Orz DhmЦmЦm4xKmmep{-K`ծիZwdQE|Cf]rDVU4MEn[&\ݑnݽnmFe^:76B:g Ker\^._b8ͨtGgBP2!Zb3<&iH@"3L(:h5X|oJrChVp&D9Βdʒd*u0$G 1rB.^HDn>4dH8͓Ji6 CNh'sie3vt1f)iJS "tz|S3Z!/\2JFY?+pcK*?7-I!dH!KPb \yr#ZZZ,}:q[U; g4 wY?*&_$EY#JQ~ fɁ,+Ú>%ʫ)MM>5D1p!lE\bun/8 eSTPja[KV.Yr.a)5't+A+8 NуA AW0T8 `83wx8{j`dA/J(rAs޲)LUJolP yNWvHLbRZyvY'ғVݺSh¯Gےү*<#HZKsOpm M((HͿzs?#˔^5ngOC9ApJ^#yw?,~G أ/*@"d0MzzA.4`#~#6eސ^6=Ek"@]bDIYbɛ,P=X#~Spg`ʼ'P?|*-EIxb#4e :No{i䏿>ݒtG|Udescw_|wk#`?es X!)Հb hQ`QxCUFs.wO7?_Ze^ [Ru fm5#0>ДX#u茄>(Dp< bizRSoAr;{ Ӿ.N"-$Sp Vd R{o1#[V&h4GhL?GFJ 'xS. G\gV. ;y+z@ώ;znGQ;N F 3Ȱ MS3O<5O{w~}3/硵XeXVĖ{wuZ6HF G1RAC+.2$i 0hp"@c|qbU}4YHq*WA>& ^~7Gr#St*.'y i'j>EQH3-toRYT=ҝDAU@3kewJҴ`qȚ^EX]fmt4-0 kS].zw6"A:/A ,yy 7q9?=Vp%ZQcxaSX?mUt >XA_kmmoЀ7ږ{Kz*u77H0\i>g1 E}c!nH,:"B+t]\`/bzEvݿmmUYJ2ȑXLn`,@#_Qԗ L 8aEp@Z%BY~O┽yK2Zic_UΠ/$S@!Ak'9r/-DZY<`eMY\`ahXү3 b`cV+y7`}Hİfۄ-(+??LcWM];xypũg+ j\<]Ð\f7S~*W xB20W^ÕU>\"|W蹆kk.܍U]ۮC4>T\o[WDtQ::70b"8$㙱8z13ix<U@a3}Ȑ_j)cW[-qqjQ-ea8QNŔ. ijh}+Lj&AU1t.t2w5vLn[ˆ"+v[=8gBWsюH]Ma[_,y62p(MM@d6IEW]yȃɘ+HmsEG3c߉P1l#vIɻ6|e1ij~#Ƣ%1^?jQ~fbGZѵ#ѡe+Bù֧|?* 5Y^~Nܺq"BuQuAݤX"]$^#7EuPdQq} cs\n,.ӤAjRGgD<^TڗΊsXb|>>1ٶָ1q+_@"gDЋ}L@2=2*Z/**|rPKy;Fy2Jս7ٔ@I䈋7@"vGd<:ɑ. W:c/( EsPRP2ʹ\ $422~6x* (OH<Z` jE+iGRk zI~p òV^`<<6s1Y?k~JG~ ޖ9i^nL={V̦R94`*ehUDLC,LmE_, 4{0#YZ{P"HĄ[Fgxax)zLk1$/px΢{k2W[yiXfpJ݄ݽlLm/NM.'G)$=I^tf׍_qq3\L+ jz'>yQ"\ƫ7/u#\(5A-&_y{󹕛otWN|te־s0mE"ecYAFYӳ 6ml8]GDFT(TLL1r[PA?FKzwuȒ>6ښedE!Qɽyg5pwҝ\6ybvH3ZK[RKZDoIˊ EGZǚP}XbKYo DK`CVFjF6GpG]8TnP}]{a@k"q`"cx@R>k`qnCY7Dܼ5{]Ɩև{o&б= ߀cXF8ᶾD"V$yD 2JC[7Vf[/niNKkXM) zem#ڰalN ^_nyV dyh˓v-'p XQ,m4GchjTIЎtSFP27:w;OA1U9Wi?%$r0ra*&_!I2BxbW˜6SFs)h <ҢRtp1C:<5]FȁN`--xCXuoٕKДyXoGqEԠ‘obߴl IV S~I1[\@Tgd5q]膂FIY^p0,XyF(B4 XP&^1ܻ//ysg9sΙ3sK u~B0D i4An2J"[ 4(S)\b_c_hs ?=##.$mȤ ej@sA =ɉYB6jm;;-OƿK8aK|1ν kk~%2mcMʱ-u>]oh2,[k#zr]]=%b!PHTps2CAЃv/6K>v>cF"Ց*5mke'l@l 4Ew+ ^8TVMO%]#hh RMC!\PU3>7o:2 u0a(|Z4s#~gpkjx؆*~EAtOd# !+]-bcCͅlƖl??8p 8l\&ŁAWv]͡a8 S<{\L?=ͣM3n| ;\ީVw$vReB0<M<жz sj@@F``w6a:.rΝ.tu5\$.|%4 B@l! hV\b_uTq ͏- {7D]{TC*vu\C*ߠeGfh.hi}Gtvxy%6W2i|ݘD;+ b#9p:لDHH 1%f~b<]1/7vЌmh c]hCA,J_>znif%bk ɩngbpiYg``d'^YI$c!*?,⍯G-OA*OI7A6f\ΞA3fZ%xX/{iVVR>l6PGeZ0p(͐8[Z̄1 oä,{Qȴ |<ҦTjc8O cӻ]c"^99Rs)G@N$qa.h3'ptooe>>hdY\[[.p TncE1W_ELAnb#m~: fgeYY-8'9/7wucre VR'+2^b[XYd}3DDx rGr8s99{9'8,1ClEB+^H+$_Qt݆XW%Mh t 99̺ahV4^:<|E88mdӍfi,&XfX[XcݞaE{<ǿwbsNc"0u0]G1gL`\@: @QWN]M(Щk<1 &Z`* K5a]0 @S;%efyEt*0p`*9< i Byr!eN@mT m5d!J僚{'F0p 6(9cQX$X,A'9pTnXr)g&T\PEyV"Ϯ S!U zT7Ȑ)]P &G h58TS[zFIF(jAPb8SQPkIoQDj ZzA )@WtRV|ĖUoKJ}xrϨF h<"=ǴJ?`JE^Oo-e $Y%A#}.tЅ^ON*dưݹzzKOܕuzzF71P?'ʑ%V!KC:Kʿ'i܇tkQ~$s24{c@uZS~I_Nw 5(B;Tz?HZMF{Ii-"YdȺGS("L#=PBk? `AL {Wq90?9A`Ckn;CQ׻T<*]4NI ](@;^AMOk>36L iZZEŏZFS4^P|uٰL:X1:4wFP#/i!- 5oDYڬ%sòpDӍ&2''SU]CA Ѭ@kBuCZd4TSPRKNyaCCud=RT]*<߲+Nj4iG=1 4eSG*)(?IPZ|P"-%5Q2PR~[*=#CB1Ia48T>Y:757X]i8.lÈNbbO7pFs:1ش`aHE^V u!Do&A5qKto' s^L~sL~uLʗ|EYřIz&eLˋИkhYBbBhcnL@V^,-UH62Jd5ZĖ G+ZePW%-L76.g(YYXEؙ ?/Oy| <  #L$},Z,.'zK<7"%NJW $ڀ;Kgb\<ր؊C:rT-oSW7V=mKyvmXUnsq[!U9f\y%pQkS]ɋHZ%r!ìiiի֦eVh?OJa4a͸ۮ56zěxyD::on^-Yyƞi3ܿ޻hDŽlUU{J!a')۹/V|]NڍzXrmK{7G7Y k}scmU>e2 sRw_n&_h~]ҼƤht?h,i W™pҝd"GUr{ʐxÐ`Qg%ffUP]ViRWU%:Bjۇ#8:.膄D -yk@3$uM7eGE xcz,qd=16 <7$];-[aĻ`kotơUDP IݳޝuϜtjK5eQs+<&orㅟv8oY[H6E4Pv̿y)LЦ)_b#o Q‹$gD5OMr@W%'ZU wB~ NJ}25\oROs:eftsO)>۔n?(`sZlguʵzkEtY9sڕgVib2v6X]n$eIMfW~1zksdV*!3C_,@w-r㨊)ixڃ 7[-~ѣ?0:Ց˯{>׍9;uvSlЖϣG49}r/+g:vl#vWIͅ wkf6U;qUc{5˭2ٻZuF8\MBiO!tnM[;fΖ;x:PL9Gn:i&>釥EOx~c[+׵|kUqᓕc[lKUaS! tl76=,ldEK<@ζw] qPҨh[bGؐM߾Rcuož&i*VU-QZB (KH|$G:v쮸y[V3ιI;lEˬ#O>^]}0 'ZB9Lb۠W_? SCf|ף˴)Zve 6AXV_q ~P_w۹s_[mj@l`M:A\c<7Kh8_'|Rq8ɟt^_ß8 srweE-/}/g~:e۽?͞㹱9@?~<ҷoފ eSY#+2^XX1b[gT ?NDSv>^;KzM#(l}a9_VGi0Vq)Я;qg/Xžb;*-m鳺/]9X?-cSݵWsO g2ߪ ϛo.Q݌TQq)36c˓m9-3N͈;jR9U> A+EgG6-y @?B.jH@@ 9d4% :B4 ABkqgk/ ^3d3(@41MЛ"o24<0j1eAɿqͷoZr986~%3Anƭo1$Awg.Jl{F6 }&ΝlMhxKgP;lcC}T%_!.b^kӿvs#ūN!-SZ2w̪XRjݕ1a{eK^aa֮6ܓsgwiDQxS'J^^zvwj3D33r3 83Ȍ5ZUN49@H0$)KA]Oe.xVp+|?{ntM#rR~u|Lk8ɗ.\j6e@;@鄇S4 7_zlx+Iswϭ=ؽ m=fqҔ +y7 xu=~)om~Z`6z]ˡW-x ymr(w7WʻZ9Oo>jS5YxFެ6+3_xzض;Nvܒ?h :ß0 5@"a`zBìruYbğg_t#o:2>Ih /""57+Ճ#SVɫ hPR2%J/]1o㽼T5zУA:ƕ_}WR7-{6yħIgM\}|˳[ M }31+Лhܣ|USꂮw{=0ITdz2eyF(mN~pjcu3O o&_q?Q/\< =ub6M&#F7Wͯ?$1,DIUGIy% ?7-L 㣆euNJPGq~+{,=7&L@W\b@gr80R]ϦKx݀3ĈпjJ8dH=  6պscH;QW') 7ࡳ8Vc-qsv? nhkN;IW6ntO\:\qѮofKp_ Xt`Z ͗Kފ^w9z;) #!ARbMgZ=M+ܾ綦˟x~GWYBmg/ie<^x'wqJ'1Ͱ ?);Պ>:y;kYBgZ6Ȟwlݷ(ʱύf4Af-} =g*&8kO]6ay:̪% i_KҀ?Pe,~X$4cs }܌u_aJ`0$ ROz1޳g-֯Zk>:<⸅]ڼelXR^&mE0%_KK-xp_qGnn7N_~J67=Y?=?0cO۴)odqԏޒ;V:_70^=͉j[?:Of+Shݧ}¢uNM0|'[ٴ3]cK~r\ikݐǴQ;1'Z790=w~{bҵ*? endstream endobj 307 0 obj [ 254 0 0 0 0 0 0 0 0 0 0 0 0 379 0 0 701 490 626 0 0 0 0 554] endobj 308 0 obj <> stream x} @TU{=0qx8 AEcTjx*%kҲڀ֢luktܲ2{l3Ж5֯=9|s2hk6bbw)(DWTV:DX~>hԼ`SN2ט`kKKHG1y{)z8Ǔ[3C5W/-9x`Z?}Vy~40zeHB0Yo tϩ`0iΜ=h?T,ϙpݟG5U_yo9J0jQlS@~yu ?344. bO9mo;.X{ n%kR*J[uz=0\_|ecUA~i\R1w ` 7cCpCHD` ch(h`AhXACEhq`|"&1Q$| ɐdDND F ia0$d q8 ĒaY #`xK32G8 G Dr_@.Dtx|ypb>\8FE,;ű80q C!b !N0.)8 #N N%"NӠb(CI8(̀rę0 ňBW* Vtja&bT>Yp lqx/*Ĺ"^Ձ@=>yP8,xWFC .Gy`>⵰ , J1> Dlx\8KaZXxnaX7"BJof[a "_!-͈w25Np7D\[^5֯Uj6 `#܁A|D$Cpw-xXG`-o`]MxA| E C-wq lD|\D<8gaVxq<<x Eq;<)muxZgwqĝ 6?@;a+.؆'`7@>D<^"cĀZB JN})In 4ĝARӢ~)br%TP)OmRz CN ==$ ),Xw_eJL]D[ 5Զ_:T*1I/]ɥa#@ҹ>v&XMQ>>[B* ^Ru~)>&;w ~y/ry))Om&Bs)b4 k}Ln c= ) 11gU)) LS:4 HR+Ҕ1mBry;}dܦ٠sאr_e_)6>R騏cj(dxӅ(Uȹk}LO1UW׏zGRA"cŏ>@SY~y~Vt{} } ?!AzJ1Qw5>v&Xg!A}LKW('OC~)>XgL*SLQv{F#JօMFct> XSq?#T-!Y,SN}Ő A Uyߠ3c1!A PDڸQ*Z/ i #1@Ba`C2LCNDm !*J|5~:;c ) JuJr'Ҍᣉ3@B#@B>Pʌb6`j0=R(t}1X?M8} 8{/S3Ğ^7V 6"AC6@-\ wm kl7ٖ"gr uû<||9eaW4,?͙=rTO҉cGdgeH65$m35%9)1!1nbcі(hxmFR*2c/*"sZ=i]вM࿰@d)O9O9<_#  ?A|@B"KN] j: .Yk^1|"ݦR;iM¬ sF /$b),ƀ\6اw+q%dKG`-u"9d}mU>XikNuj&j lBrsl>59VUG/c [զeV>WE߷QhuͷqREV;En-p8X<%ʕ68(Sjs=Vy̵z8`.Lտjm-uVG ODՍtUu1` 'xxAeO\O'c .{O+ mtpdAn֌!ثd/$wZ::TuHf}LLG: [a#\ֶ Z 8 #cWx{琑xOVX]4043(u]PP^aڦVx /|J xxF(++kS[]j,'U6Җ-Ʃׁw&3OMsFG x9Ҝ҉~?gvb>يK>INhaMO^ǽayyE;C|o-*0 `:d,E~v7@ʉbX'#Pq-nnfN6`+J[VՌAiU;uSت&bm^ܦp[ckwҌFz 6Nت_DȣmFg+a/Qaw>[V j_V`*izh 5>w^M{hmDx%u ^m|nGA9r8;RkkGp Ȍ':\Ez?[Uط+jf-p=$DšUSiuh^  V}-bT_r5Ӽ6Vhʊ%T8Z@AFEeOoRpFY 2Q]W"0s2# O&[](hۭcoZ%Q@,r<Ⱥym@ fpczXguѻG ?݆w->+t~B7ߺ/vil{erEо^֡ \V۰NrzpzdMBuw.wӹKs~:љ~Z}|"v,%3v0#팻Y7~ {)LJW_CxCl+ʶb«[Qr}A_˪q1׻^M >d67"1F ?vbz3ۄmLǷ1l#۰&T BXޒ饾}%U<ALV6% +ZV.o ZR}).p;Z}-F𫥃Ra)!ZHK<7KœM%8wKɒՌ&܀ĸ5biS)Ĥ Gͮ"1(Kh2kL*XR1Uԧ "hyZP+*T&WB+%͕JY֥Ֆj\eJٍ,\(YGHײ OT94}H|ffN#q.t:յdnUU8s:*[H"`@|\c5MkVְָٰw.nDt6Z=lZpAwwa~-zx]mrlwɅ^6SPhz8fx/YIsN2i}7Kࠈv:NI/\굚,%5x`Gx&⿻(<)f6(;!0d1#`X_DJ4$Ía\ b%8D ByrDM N(uau'QxHXgxtJh2 j0|J&¥QP>7kxI8+~/e8ɵ >^&ޓg0]g% {Y?+4 <8Œ^:;dn-5\xe ,w1#i@iB,ʌ.>'鬄\;sqnM&ʍLwLA*22GbbRbbtk:u1&cV\I\1veYBdbcĒF3eٌi3ޝX2o/X2,bA ^יs[ 9:w+fX& :n  iX3C ncpUvVR23(djZ)9s kK .8&^OJƺ͸NG*DnxR њdL S\\H) +2Mzc6jEj4c1 㪤kVݙr:sPmʧ2 wDBꝩ L-wrWX=9إrJTKH:TGl.:饒lV":|F:csUŕ7 j8m̬ Q(6 V43iBUT^]mW:͖I*ԛǿ[66 ŨkaAūܪ2RîStT6;Qf&sȨ"q,[<&:UIU.ER{XFZVv+J#*,;$/%Tsj yE9tvnщ付YW]8}_uLv^)qUGQ>eb\l5 IJjJrM AP$&/Ѫ ZJĂDK6*<d=ya 2ڛD@ DҦH\YhpMQhzsNK|QUTʭd;+=O_ ײ!N eC *ŷ(T8zW,iM4V>JA& 3ijFHK{i'+FѤOvx`P>揺QQd'XDrE|r͖\dn%$m aڒ,$ D6B`=K⌉ĉ1::9Tg'>u~"VjF :?LY 5Ew%ExjpX#RNj#o^7\b^/K[~~Dm-ź#˕*k_;xLNct}ՙۉUvG8Q~ge^[I^Gw[!:QNqT $!s8`6w1ܥ]bWے"V67S?FM^팳.&Fk1N32ɐZlᾠ1,%?=@$XHQEzS$7.?v8qV$1W&-=^-C >^.`XewNޱ6~iZkJu*M6' ݹ.ְ%I!!1J4isvD:j/7,ex$gѴhN;라ר 1QG9&-?L03ĝd\2+m1dmQvrH[^yR8~#InjN?cF%12jHSShme3_ލ$+$~7Yԓ%M)RErtQbxfKw=f:ї閦Žlw=9R^gVT<|a#.Ms3#13'cJ&ۘhS`}JsΉ1*9O?6ǒ6fsv!Zdf0/CfBXp4wSU6b18:Bh9i2 QXN\gN/AmCtezoC_Hڑ\a# ㍼aîuY4|rkʊ!S샋w%;l)^b娑^7ʊ(.!s[ 2w$ )PP 9$ԑt[KwVO)F׿!Q^g}aKx2|uY6ut[.^S8헬% F#SvOMNBEˁ% =o*G4om#yNĖu50~Fy9_ίjY/^%>7+3>Э*M{lilS਄W1_L.a4R$gV7`+HV1dtݕNWnߙFY!æ;Ǩ`& HZ#&ʝØg S |d_:~lڧ(@ )FYѼ@$AF>!UŰޕEuk$wa"ȠUaTluqV?[֪ZնZֶZ7} EoG盜ss_P;cge;G[>, ,_[+Qapc(0L_y@CnZm1$}`rCu9YַKzex}\Z:|pc[7 quz ?5&aG{A]\|**Cu=$%SK#"zTGՈ6𮒇ӧ6h޺Uݱr[VFωdOt]޿fF:_D2I_2u"_i^ge5wV޹Zyjw:\FK5椛Q9FC1Ťчfet\u6WkM 1fRԺ\udLIfǨsզLm29ymH봹nV6-'+-IkԭC[Cx~TѤ5%6.ńնG  Y:m:=Go USgr`,l)GjԦ4]!+ XOS:ME-Ҕ\Ak֙LhnT'Kp#Wc$`IK5P7ש|NԥfV,SҠ*sY&jm(8ZxxN6jsMF]*Gի 4Dټˍ:<5-'_{Tހ89xv'iFvL5󥗥Q05 'FڀCT!@:Ikq rt$w,E"/d^"բ8Uc|D9D4Fj$cǟd"e_?*$r}[2 rv ڴcbei#4GOxb0D9>o!X]/c@I\7UnE+_ l2{(Ged xJl5rEI!OA\N*l#Ԕ@'1_)u/KKB<1Ӟ{^'KPMP)R>jGzyR6Y>j=M<&sUsIT>q:T\,&Y۷ɚ|!yO{)U#6lt "V n+{^2K?6{Q3D'k(i[f H{ߊP]i@&Chǀ [).cK{%E jryJOҘ^W16ZD͚1P#wer~&c\)Q6.HEEZX ýok"VNW}[K&vmb乶Λ]?a3θƻ&\ nsN3brxOvswyYZx@pVk;t^σ'~f-pAh`";;ٻ!{!e}9 '{V@ X &`sY ( ("R Qa#4Wa%uR-er~ʀ ~~~nwP.p<@ Q$*De A2HT Q$*De(4eG X4oSĊvV*B[Ehm"UV*B[E>j-EfK!)/rBRQ 9J!G)(%1xMU0x x `.*0,+*`5P`# :[6 `xx {Ip;p8 | //W"p  )K̥]1RH IY86ʀȻ~n?;-o ۂdf| Y[֖,@6,a`T陞=h9Û Y^f/!|6a B-:fn{N[La$9*m肤䌷%wɝ|#yKToJWR&52Ԝ(ZRԖܐKORg3%uRO''w;+JPu:IK$ϑzFo8Q>?ޔݖmyPq(abKԤ!iFZ`ֵ߹ 0ja~7`>&ΘćLY mvL MEl8OqaZ.,9"^ɦfxxg1%"˦D|SķEnjef1]ad"ZčDˇ;{x/$'x3sutID7ϐ^v1ψ/>vFEXX|J,aDS61v驱ꩱScƮ"vcSc?kaķ"Iw($2dYUh79@S6!9=* [ i|ӷK9͖y˩ܞ]>Tyۖ:ƈc|%@,Ċ'{&+%,Q WiLzJ1R/G5+R$56K!R(,F ¥R+ԆFlc)u}MK=3鹪>u(I*] @>,$)``%'n%W C`kI>R9W+SDd֍X5fjdYX7f9l.{k"KRrl βOl;ְjd^])cMv}̾({=`_l[, &>`Gw֥o#f?KxǪme`A6;N{)!;/Y)̾g ~ewCmf_7vULJ[XsBh V/E3mNh/|@Gqf R$.*ng3=ę³U/YUYŊ3q¿+~@ /+AxY J Y Y g3pqf`830Rx_)%T} K+t}e+Sx_:}qf K^Acc?fXL83řMDMdqf#M>TLuDL[ a ?qӗXAnX֑ b|elKfϳlRR2,h6elxk9P hoXXxuG᳖glŸ۹Ֆ=N ;ǔJv7-]֏8U +m\5 '[EOq0D{jC85"[ Vol}{WXp`>w$% 6fސm?xcR?ϣudL  y!EhKFhGAhO t #t$"IB' vރ{Е Xo'?>~pl΢uKc-]Viwޥ ՚k88{"Wa_q:T7Éݎyb{zo٥=}2=ڴ#w 7tāĴld^mgBz`4bL|@صV"ŏ+Ј*wU(/ڱ+ѭ.Mz],|1(h|z7h Տ]vk]n@"NGӫgIQ箩Ƭxn U{Qt"Fe(h+11(Ujzkb*5lF?V<@k|J&緡YlRR֘%v^3oO~ʵ7؆7?ޞ9Z: m^xhgn}\{/?jOoߎ8P?ظ+^dֈv4)EmkԃF7֮KI?[I^4cyzRKse_7@˚pn-5ul }wyiI=yݛyhi)Mdֻww=jq|ԳS?p3f3vfT)>iFrh[i9 }2*,D6ㄜ .]bҪ2s:SRM+M˰-5J˖~3Ь^1M/}slYN7Ǜ>fҨ=~p8;`Q^ voYit~nw\Ko<peK+o`w/_54H<1^?Gۻ)ݘ ɗщg|tIth3 Lp,K?Ѭ§Kv}>Y=^]CzLh4}{Ǻ=lu>br5/j>U&a5#7ȧYF-6q 9P@8u̎+deIG 퍜^J,Wي~U Z cɪ`a'v1xyx VK^%ПM,P.i JA-##b0H4WtR@a DQ^"+8p2vPrn_ xdy hBskSyٝ ?H@ Vh`]G\f  k0@St0!laW*go_rʳ2>QNy+z ɒXY*]IOd[l/0'a|#PSD /q+ KC|Ĩm;=ؽP{gb%Rs z1#n햴[9Қ7U}ʤCTL2G<4"k*sxP;,;1 c;ZV܉=3$nDTNP[lϓDGϱzFY#+b5o\B3./: |#m'57oF;%5uJ2@)q<@0LKE TR| qP|~]{LC~WGdH\,d1g0(hp :~%+ȗ  ]` f{pL7}^}E-tVY;Sd6S_fXP{sx_YD/\okdsU.Dzs-~MjCEg_R-VSQE4 ` ,9(_y^ZN.xqȡpWLZi¤F-rp|E`+EfnI\}2C}g nfG8ـ8[#ˣ.{S36qod,9^}eC/??Y|2\(f$0D`` 2cTQBZT\ hB50(hPp_qVxȣ &5qg+kEI~Di$'Wɩ|Ax 1;B؀MImsuq6oڰW)<%U􆕨p|%)/>a䦉zA@v1/ Nw 㥲Y٧owt_A >7 d4 h72kz{)Ǽ,m%5CLȋ0ש3 :G:"W8H5n!&+m]vEǜR}j. .X~a~^(--jiJ"!+;v&`vNI@P͋@8 K ^?xdv^~ģ\HZdݾ~9]w+=YWz}GW#my*43O@,œpݏ%Α '6Z}J͞W]_kİ6!ѧ#ttĜjީaZFmT[UX|FhçNgE<֑?q (Kʸ˂\|(a0B4x=pl|[^{o_w~z:K.o Dg&sU)C]v'^Tmbf`XC6nAOb*R_rͦb~@WVA +&ے_Z]&ǹX(B@@P %YIzPrÉQ,bhwf1؀<|m"W)j+{|[!a pX7eK63qu;Y/#tEOlP@tg[;o6i^q 9G8>^81 / Um أk+bO/Y?q7Lzp@Bv_X%y.,ijA&1O֘mk ua[d|ҕ|Bc9BQK;ȓif%5F%qjRw*U]o [tVboVb|k+3jq~?ΪTSr"}Ko[%\b)z9CSlRZy"P0-+y?ۜmO]yD[|ub_9$D Z⑚|Va@+=ջ6qfOh˾_O흯Q MD68ŭ adz_ 0~WgZe|y") e;bޔ?x"JYYD&CU gY} my[w;3lia11 2y-IrZ&`W V*–tR^zd[ŒxmaH`W$TBK|iQLb"옉Q|/cͺzTU`굔< F w z[,>arnBH/AV endstream endobj 309 0 obj <> stream x]Mj0:"vVcHuzYZ;RB cy k@ه@Gm^: 3 7J# ;3ZRה}bs ~<xm&j{`HP# &f,ɶ¾5-0*XVCVCǫjӎiϫHeY!1sv; $^E9 =&OJcXm~Pg]T Ex endstream endobj 310 0 obj <> stream x_-Yv׭T*5x8q\oK6m34M;3C9vf!L:< j$HDo>EED3k}wׯ'1xSk^{߻쁙}l;o|?/|w_}of˵/~'t-7ɬW?Ώ~CU~JoѷRO~~tE_髟۟w_䷗{]Η?[.xf?O5ߟٕ+緔s%Lg{mvx2Ե}/ھxn?0.qr?iA͗j0qXf9z9_*+p9?QwBKףKSk37?7qQϗ~@|>-)ez{)~E[qעޏƽq^w,Wxhs5xܯGMD=k{s9޻VY~}>aTsVٹ|{^)ǫhGףR-w؛RG['J+)Cc9ߵ7 9:e&>-'sie*uʯK=O˕Я׺XKJ/qWU~}lmѾPWǙ~Ε.˯+Sbb+r~ϕϯH`W?Xe$BoKkKmK{_,{;ʕ]Kruǭ\XsûJ7_RˋR`oYcʓwܹ.Tbyj)YSy\\ʷRpKΖq\K?s9ުoEų›婧mzS1oU(^*?#B9Y]؟z_(_)^.=xR狿üJ/ϼXx2Cq~JV\9R4s,TZyz'JSiu+W7v6h v(Yrg/O8,S%F9V)鮎T֒9^^ˮ newP,QP3L]sBp.Mg߇lJSjc^P.KXnYfȒ>sC"T]4EM]fߔLmLn->oP1 ᔐ=T ]Be>fY,asoGKc1Tuҟ.jrA })˙d(Src@1%mP ffu>1w)̏>55.tL9^xoĩuzO.]܅XM8[6ך]bOX8ۙbb)EKpGBelZqb ѪӊA9@ owDojs*ׅ?)vxe}gP%.Υީȓkkѩj#ScV]\]sl,bp)J _ٺKkշvZJUKٟ?UdYu,YsR_1T) \\եx00V Z{׺A;K`BjO~[rTyjSxjOsoX-oyM W]kB;c c 0v[Gki__—)4T}gN \>XvMHRroUCr1*֎W+:V8V\qr_k\{pv͹έZ˘џWcP|~;U|u{}C71/*NhA>7䚒rH얗Xj4 eǘ-\+tuA)m{HbtJSJbsUmיZڂ^r0 t;uu_7V:VpP8\⹥T-޽TkvVZ:k4s΋V,qc5Vױ6-kNc>~/sjcɾ=6ʟ*C>! ٭Z*sPZk楖٢5\wsCaox ZBZj>SV|lQ%츥]bs+hs JYQz j-xGOsx"tkнs]*Cs/+c =84]|jɹs09-gXZ[򗰲;Yhib 'gc1$j65ƛ63kPK%^17?Z J^B 78\`<>9Sx%uFl=Uι7U˽^˺2x~SMKțŽkJx\0u7q\KܭK# X);ΘқAsChOS)=v_;c 0i%5.}b73{^_49:\r,O/t{e2DshɣaLQn6CDWGg[Mx01(ΒϏas\ h Nw׭nYR>ٰ? ĭ<Q<ŵij`y['$bנ$k56ty8ı -I3$y$9NH塕s1ok*ќdԒ<7ж0?/J O'sZ4sLXm`[sܡCs\l4$m\Y>;_kP*'qHu)<-UA'|窱.Rwn0:JOLeܚXp5js\I3GIjXv=sԈ:sS/En1sܺ >~m0#`R)]5<}$V3k+"aѕ/*MTz^oDMXc10D][B7&vj؋;FOO6GƦ܊ߒ,qmK}dȞُA8[ߏxٱFm ?>dsiLpNקwkD|\Oח_1<[ }s5Eq]ӿhJsUd]%JkXs#:F2T)k/8hH޳}˪ "RN8}H*(D#-aJ9fXtV{L#x@蹽}u xĚ[mm.m\ͳ5Yg@[~<ߔ@6VhGc=ZEys. fJ7Tr4K.Ϗ%xda)}uԼV]8IK|{'j-YP#8^ v.Y^)|r}] _bh=W_ 4s`HasȲٖ,?m)1!ox-`\=YcAYBf,hT'bO r϶| 6[y{{@;Ohl&es1Si\ӥS|LJ]C!<>>ޜb $=uzzEEGqvM oS-vLšr.":2V.,\3 Rc=nb ۩r94h#]e >1|ex\Mna4#ܖ5(1w&b?j[c+>®`@oEC6eFSXdΆ.OO,j>Yjyegd$(й`x]MH]򤙧@|G**4^-xVᄞq!YaDK*ue)G> #]2܀bhS+/kKsh\^-an!3]R.x,-/E\O|X;S|ܽYQOT{i\C[vXǗ;7gf1t{X#[#Fr:w ݣu?Rp%atH|\\5۪^=?{F=u}Y\+$Vk:˙s{KMk8t9$ԥb6,M^j!GKr5*9VeٵTf;%>wԖ]Tε}3uF6_ [x#'b&Tvm ޏ*F#+g!}_nW7>fhB]DjNc"oFA۴ |% .2&lqߎ^>{'dyN_7cEc-{5L4H1"tao=j"6z̿^p~ Ek=]y6bFƚڥIç]g%uڬ{E #1!Kk4!-Ykwux\2y)3bX2,Cԥj.kȷ'ϡKU-P/aLL)n!ЃNZxk,9Fm-(])+=~9iRس;(2Z( 6Ȅt fׇ얕 YiUSl!絒չۼ#m@lxYBܱWByvٜpEr\)q5Eu)~a0Z?wK?Eyyޒk,\~\wֱ{Kwy܆SOOСF,NǞ&Z>5%=T DZ/Ž>~-9%p6Ds;e쵟Sk[M#6w(oi309C9'FDi17(f4^SC`zA&O ~dag|~Cy+3LYsqK9zn9,-y٠[䱸9}+Q֊YS9q!8F%YY@>]bndx݋-j5_EO'3} -j " 옣z1WQȝnz .ldlDW/j?I$g;t/I# 8LtbLl1=}Ze+GX3X FV50XHGܞ򈶀j6ſ@TsP"+i9mߓꚌ#$cf3{ܫHnP)9$nU ،^uz, "㻀vα\ ~F7茵sʓ!h̀rj|eQPjÀ[x4ckXK(9sJIOwHTvwp vCFf B=Z}]5 xjw24>-JCõ%M+-tQ8, /|\]H_!Gl% nKvn=H䕏є?I_+MV"J>P#OcUS6n OFHVKgk^űѿSe$]X|qM3o|d=J;x:&s>h蠲M/ 2C6x$8׆QM1ˆtjrt%dCS}bdmcE dKD.YX( 9%>2Xxל'=7rm[T#;^}qL_#s̸ w_RњX 5j0L9{F'^Aɣ)Kg #/!IIf?d9XDV9%b2yj4!dm@&99d*#B9kΣ%œs\s{l3` /)29ߘ򤖠.Fj/澶ezbdzvIʥSֵȷuۤ|{'/5r$d\)Hט}%{= >(-@T+zZ.-)zFl0i7\WlIe!߈7W*CYmXu]O|l[1(*ƨ_[|G菖J|Tz3ϔv޽kUd0C_^wX#5%d7}=Yb_嘑}3,U=/ds#|7kQYb-5 9\15Vx9X٭FgDq5<Clܡk#*G$=fi"^"oS#gn&X=\fxKV.@6AQE1]7yq6@QWŶ(9g-msGEo(H:ǜeo*3O{Ԡ茬zyE;iej,ѽVpgS6F0#tM-ԓa4iqm4hĉYiْ-Q^>",=&w~31^j"e3Vmm9#܃c]~ebl'kFT}\r̽.9=#ҥ:`.X9WݹvE]wz5ųS 1vG)Q1Yw焌c]SNn)"Hs:Uh`v}zjD5~Cz:ãNLt1IRJkWa^Rka6<Ŗ|)kgb)s\ >+.8CVg]3DZ%> r9FT\*?%_<$WZr[)ll|gCjKn/Jc$*$ϟ( = i k:jWd"k*Ӊ5ʒS@ڧIY;7uՅ+0޴AlahV Cz# /Ƞw"g:eLjcZ'/Ŧ35}A397#މ^=˷0vWU2p#j/I`J "s(X)o+{+Β)97[lL87/k-߂ιV!@a3rig5kaLً`9m%.*CڈK(7Y6t1%S%29B1ⶭgkI鋏 hm[xpEC}#C#sj2 zsGvhi=D-;O;VяSr;,pB;Eް\XX[t,)kh)32|;XْrGې(FѺVr yVYc/MpeYsX &HOehŐ[jCZurЀӇg߹C?$Kvv3<{XbX>Fd-j EBՊ"פ;311T_ c h-593YJ[]N?;Sr\.}BkԵÊGErh Súվj-Ǹ-tɉbt +P80" ~of-ʹqFLY '5VUz}j%N fb} O(Uuq%KS)f6.( ג*9I^ꚼ0|L?,;i\_Sʛ]%f; dwuz6S}k57k#Fsd=`*2 s;#oiz|_9uva9.܂ vrNZ 8 jŻL-bV s>N,jŐAKF kZmaqw#?9w]]Ny|$]%k&z5N,0Yhh= ϥ"A@;Pi()#`dec5c@8S ܖ&u0GnM'{Yd!% Yaɴ}&ςt!x YWcp.3Fcs- >Uvr5=~AiCVԴWPf3BR4=ExKcg`(n|f F5ɧO5~'H؂r5|3LU:y]74ؘ+>w٤}uȮ3<hհڬ+y8]gd$"! A6'B~c\~!kuWnk:V[GNMZYDGlq7d78ic[CQ4vcmv]&_@ÓmA~lo8[ُo!&:>蛫!yvyO aI mZx\gޒz?φ-oQct&`H*̰Lv-t>_8R+l1H*# ordžǧH>~L,2mlJ^;h**{w6 Vuc$Lv[OW0I?yfʳkbN!6%ifh3WH3@#k=4SB8Q_0 c7RH|fDq~tG 6s(xyhX8׭}E@`; TLQMb*sq"ܳBd%y40;9N fZ&ݏ5D^v]ŗg_clW \ڋѭ$3ۆ {nA֜\꿫غk>֤kZ̳ޏ5P/o[P AX B9.VKo5(ps ^Oң㵵)>Ų(7wrڕΒh|cbc^cj6d9ĢVv15<KWųi#|xC[S#\#ڥRo~)N{ :&wy潦gkPۖ0J"Td:ٍPSݖFvS.YKZ.-y/5V`T}\4▾]@KqO$@R3O+g,JGz<@$DWFZ:c#`UGX5[9 ?2JQ{ԖuߤGVx{@ƪIvFKLݻ[Xq _cTw_Q;m~>~֖kǚW,&ļ=@xpmbpɞ[v9֟QEw?Jq|ڷTA[\6Xn譿{x,.vwEݲ<2_Gu_4= ]Wg!ptuE^a3 7>m(.&}sZ>+;c)ɠm}4Dv2e66H!B~>${!+T;yCdLCY^j 2 --k3BC~6IFZB{'ӎv(=8~gwU#ݭ&|wY^1wz2*ciJ-,q'}k^M-fhmEjG ’}α#'@kTnZ&eJYG>9d~=513ZZOsj(0& fV[Z{%8D1rDVn}]#u'LEUTMxDy3Ri1wͮ=aLB;@Xapx~qkstMq kkG tj9hc߬ج$-L{"< M߭ODx)<Ǖkw-t3lM]J;P VNBshsmV;)2g[94<Y)ŘCz\&-Sh[I{>O5VU%Wh =ޯ[CN|w|wϡ?Qb-'kzf;.ylyFy k˱u"{ZS\q?Nv艮hI3EvNzAC-($cBu蘓рf_Klyk=lfWFS>RN[ ,|!ԧ= ݊&q1sTXA_t)9ocsgHH[$$}!EjΞ1g bcD=]¥tk(}Nmٲ]d|G/iT$﹢#QK]$}fvېlI /@{Xo)tmhիZ$'e{Jƣ$-B5Îc_6dQu,^1hoMVޚ\}PD0̑![h{\L`&MKõv31ExYeZr1ɯoF.TeœOQ>![0L?$#cHY軆5%kW[{q]+?޳AO L!K=Xe ZֳKSAc>7[{aSvZ.96-A~ֺ<ʨdyW]B1?z,} n66Pl ."/[8I959ZZFǥkoK2EsVc"dBw7X(?;yj3V*|uShCC4 dўl> nFd+䱒lv]bh~ȃT>ztɓ6'dXW] "AȮDV,ώF^\QT[mKcDv^,p^=FfMFHg}vҹ}6dK铱W}zQVL!wuE +fH8o3^i=~tPvzkR"[M|--ʘƪ-ȫ1y~ȚΡWlSR֜úqmݍȆZ?D\jƙ Xm~ !jwU;'oE9윌H21։Y ;c5Rx̞揄،6L ;Oud[Y7gxs٦QC|j[ ;g!Pn=_J9;~>a+~žZ~}޲7wq*W?n/qW5Ϳ]^-W^)W^*ߴٷ/J'r<+7~\}Zk+(|i's%_RzȾ8r~~ߟ}{p-'o]=׿\Ͼ9{}?VysG{ ?οnÚ?3L!$CHB&LA7T@TD@@KUJkQܭ;!j*uŢ]Tq_P#Tm{x>r9绝3cNli-n^cڵqtmqs qY\6}q3=|5%W5w늗 fbv[0)vq]*Ѵ-I>E)1n,1KY%bk1>Y⚶ga ?}a'2䩦sw/4BOǽ#f=p> _?xa  ƪ`=M1g.Ԍҍbh7 hLQOq$)څG9(NHf. ɐ̖JH nRt G>W*1ī:W*V hA|"`F0"3٦05d9`$r+sFTcTc:O4!)WCdkA D$Ah!e!C$I !pAǔM7_b1o\H|>, .>nioo߱iKUڋ%]U[[J\\LuݍO(.8ܜ5g\\n"$Cҩ P`۶c0Pbl'kX&"0{S2T)ΡVߓ=non%58NVf)"帪PhLb2@'q`&ؔDB?k(w, WAϾ\#E"?WO8Q !Iz $D9BR`/!igG8!!#I"ɯ̚Ҙ*!˖n4ۉ7'L6K8MD$ɒɲ BfJf6XX N)P 3Å ئqG?5ϱsd5 (W² ^`((k%KBRS)(ͅ62 ERм-TYJ$v"Qŋd SRSh;60{ 0+i3Xi@8Yb֐7;)& Ĕ%fQibg>ՠ`pDXf0/1Yg^qr5K]R}}K1c* 'Tv󚶠EBA F2.$$By29%#bZ$JU-l 10kII@ EI@,KhF,=nż$b ltJb4o)b~]M 2&>Eɡh7|~O\44zB/JK CKCyك7R:Ӡ·J %$J?1Z&s:cl"58SkPv)DbOxӗwbc@`rrl @nȠ%a;ظ)PgvQo>6xc#rbRq]JѰ(0X'≯* E?FQRICCԂ:)271|@2r585^ >('y3*i70_' AQjkp<^$d=b z͂ښX!LLTn I`4[{WQ1.C&-YeT0]5-1?ŭ?A @ @ @ @ @ O @ @ @ @)B @ @ @ @ @ @F"@ @ @ @ @ _*ñ>i#!ט&0nJ BLiTrB/4\۔1oJߔ4+' [Ք.>M0~KUSsMCZЬl8>?inqiCRݳG@[ }tlʐÓ2{dfTzs̤A)#2OI6rE` ,aX6KŲ;MFb)MޘtX uݱ 1%AIJ{c$lԎ0u?K8Ӱwgq wD6ڊj8}/^Hoh0ƍZ÷ukIxL8." s(qStc !bp58Yu弚خbA)4?d6Cn[- s{\l'3-s{ٮMH^͙}'NtrV8;JO2JiCF2GgeSǦgYr C/udoX3mD T҈ 0#u1i)lol&u٦zy.L`~Q5JQK -'5ScrԀ]7Eu=Or\6|N -[pIeK LBJP9W6ɜt\gmkLXfR](FcSo~35oۇt3],ɖ'n%&޲m?m(9x9ʚ(춰bԹ w\7ٟjY[Ng_3uSzd.$\BK7}༘]UF 6׷܈>q12Zq q)#>:+EN ;vGdf$t:-wX׫rqq..Š!rq;0>)bAu);v٭;U` k13?ﴏU圧WLx^'6/H(Onq{ wY]~pw}.w/b[]@z2gjܺ-Q7 .TLJ(<s'=Y}難vv('ܰM _;. Tvc)/+|srx,x;_PlcޣR2`_8!fCN2"oI.# z/55;dNWѕVs9۹0.<`8Cç;J'ge|'+;){tgJ'|RMpMLO9Y𣸐bE@s|$u@^_,-?(3dAͣf'Mo/~2NhMPǹS-C yHrwf%ZUӼ_A)tV͛W =ΧO$`R6ЅdiR'O~Z@ΓsotO!rdPG%ggΆNfΞml&=3)NI:GΡ1Tn3:;5=3-{\֤qɫNk/9i ۭE۸\E?.__eW[Oj骂a{ȋ_=X6ݶ``|UϽbK.>_=w-zUͩK'mʝX4. jv,3Su;daJ;Cl/6gǷ+fq/?";zB7Giݝe }ޮYU?eX~/[g > ډ+)UvIs9kUd.gϩڴnۢf5Teol\p]3ǚ_´pGn;>{s־DZVzĥwz؆‰Wt3CVCwŨ;qӼ: 7X4ؗR$"M^2 M##\W 7bʽw*wjv ܭkN.(|=DV(f_xBL*_thf|7bt&`6Cm^-YyoˑQfw2Ϟ m6~]eYP޼+BT8gMgc`W7dAf1әF4Qugoo?D98W*{8>A)meAF;x{xUe6?_5t7"xoa“Op|JRxQd\'jgKs;TvvcʳZ6ozKTCv)̂i=^ 5 yg w0Xw.א9E0?NQxNT ZRjz`#]rp1>ye KK}22N݅oC"ݽ'WoKOu . X&xqΐ0J"DDxq-uz2DvˮXT\zR16 I{re]oj3v^?倠{[5+9cb9ܰ#UZRkϑ ĨTo5/;k=+}3Yr6gPUWLU2;O)ED?sm2MDhzU4Qs]YRy\x x…gK,x0('g:@h|M7_ ?L/?`;:{Z|͜7bMfźN\Brw,º_o,hÿ%.rs3>$3)#ud.u"娇j/P=@-;|}l~o .1%~WZ]3gyMwϝ"7LK${P[lB99y]<=GnB׋jԣ7e][mU>v}WLRcmxf^4_39;^sõj_%.']\ٍ шĢ\ KtJKBцK' ܋S57UOց~|9]KzUc QȽ`O{XEY8>I]6",-Zmta> o1^aGFqtN{\TS+GU̹ufȁeWuONUi> 6}{s/?o~E?/Fv'&MZy?FhQk?khV(Ytҕ.>Tg\ygL͕_j.~;V!VGyp2 @w endstream endobj 311 0 obj [ 0[ 1000] 3[ 500] ] endobj 312 0 obj [ 500] endobj 313 0 obj <> stream x]j0>Ea$*=nn%}fe (LX+ ae:`' 6n;o Yeu7T {aO_:?0]Yk; mw>1ߊAWt!7ӹn7F9/ ORd}'eA4j*I҄H%Hب٨Id"Qn(XJ(H5dpaej5⒨"*#KQ,Hxq jBqL5V&3A5Z&%O17i_rMSV;J;U2 >Y=^c9R:#%nqy _DN endstream endobj 314 0 obj <> stream x̝[uu;{}=w8=u8nsO\SAZa85I%*KTm$J <T!!7^ys}j>?‹/=ۿ7̧ Qin>O}_hT~}W^}#}T~F~o_?G;x}Q4/vg=q_|s-_{ࠅ3l+)?>\|뛯~;?מQW^W^o}=*mǫ/kO-ZZ?h_s//şkxwo7w4X_/iazѿm;^ovܿ}i9֊ި/^z?|m*Ff?x[eԾrVCwG?=Uqh5z|ުwFQŶ-ʅɽmo[}.gG<=aT}AGrbT7<ٖu[&mm˽QmyO[nuh7y7F2o2Q><іwE>M[i}Q[vr!8^6Da8}Fjۧڲ߅{4.۲8N7NcVW|0hhy8ng\o<PQ*YVKejmŗޯyn~>hzg[>ؖg򡶼;kTߊ⹎my&+<>ږ k?ږg򉶼Жk'Ex}8> OF1ѶH} >x{$2R.EJQmձ껏Gy!3QhxǢσAc\=\f[n;mіӶc>+_r[vcn+*ի<ԖiZ:lK僶|9_jϗ(U.R${^i/~"1Z^ Mvaܹqlv{[Q\V"ʓ1'dG<Ѿo3nzYmBŪU?UVٿ72+OU]M0x+U= \7mt\O]W\mu |}k+$Ũ?+kc,ݏi3(xc{>~ = - z7keܿtR&E[ߞ1ֺ*?Y٦ vJltFyda:#XoE\?$owK1O?oŻCisjq}6 |Wb|'u=`wWJ+1`xQ:r=yRG:wG'R",BgJgg.\k1GU'b%Sj޸~8G0 ͠ڸ T}Ox*?~X~ŮU>|1iPe qsՋ*~},t1㻂ٗj?|⺽|[(ZzMkQ7։Wֆoa{=u}XOY4vi鏳,}~籵XuV$ Xcܳ>A~&/K/+7G;8geٹ?&/J9ޱxx/p9߄O(3C!nr9?!grs79~¦ux<0)}"IӁ؇'vٳn9zj2%Ǵ]crN Aލ9Ɂlƞ'C4ll,󁶮3^fgxF:3\629 Wf!^;!~l ోbš}ǥ;ku򐊟|Ҵlƿ忮n3]kC_KM1> o]S)_^cUnJåBDG~b#KQۦt5Kk9kW7,1-|$ KEu d{Yskhʌƿ»;凪^9xKWϗN˦%/5.hnd5e=Y^krq/w 7}-+#kP$OKg;4Wx[E{x-lvz[B\.{lП-JsxŻ;3g,^,VDUMI.1i9_yxe<| +J}wjckWtpūYcj3 9 qēoV1,k_b諽Ut@QIvk*ɟIm[㿃(;hPL7/]!{tK#SQE[PyGJ>0Иg˶~?x.Wto-K' ox^-y(n}LR6tPvUqME{ CRkFD`cjPB[͉|F!h*ϼZ:lѫppHă} G#r(kiO/}f3{dQ,(_)ݥG.})9,Yϼד/,^J]A1~3`ֻҷ/e> vz6o{H8Ӝ0'&9YHq?|/~csS=uwi1 &*iړgH4K$BnSOKߎNX=mA鏍k-ɿu􋗀PFS,qh}eMK'wβzG5qR^3tQgoD]kQw9F_-]N\ 8r{5p뛁hs!z,RRhuc.3zfDi13{"Lrg0s/woOu8-Yt 6'dySm57ގkiR7\g{s Oge?5܈SץՑwk8|i sT"/bng.eO #L&4n/\5f?/$e;KO9xOz82/D{U*^dyy憦 ,1U{gsc,=;L(=\̘ $8Ls ,]P8eq]a.:KFVs]}#T/n]A"|Cr8n>׽//icMs/f\cgvȜ>eZs4uC {L7]6G㲛*x3R=s㮻4k7$\ӎgz.]xp7q! ``-n|>Jcs||fqmS\ؿ)2㻙= c%6?s%ί,dKVHcq]O6cl3t? 9=/|GlN>Y;ʱxn\6'p1ee

?Std_~a>α\Ϸ?oJ9W.mϬJzO!-jG7K;qn%<{΍(f_ҷ!_\m.W^5#[Yc5.W9Fe^tk=NmOF~TNٞKK z~sK,});WPng +h3Og-û|t^M{-B.͝uONJV7A΀GE?͹]}9Ջǂ[Rj}ږc |WnKyDX֥Oړ~y(xG__-~&G7C]O^ųcyt8Sϲ,p/>J퉟_9]1nwn$zd?_w#_4z`}lU'F hlsG_N%1ϒ/?!9HQ~XJ=.\P{_+=<!^4HƮDa.Zp%ˬ==nm"8$bcL6\cqܿ`.pk62V _cs PBL ϞdR6g&+3[>ܿ×0o|%/{6TdOAƶ3c`"H;' Ӈ=|/ǵ3)`VȎp |qR?PҧAm& Yxe!֗lC(\ 3@M*xy-ɱdS1sGg{mcY{>smwZvJ?sR:ߤzuꔯRbɜ W#meQ)߲wCGx"ԇ6B|<,'<#UOXhEjLƝ P;͹P|!/.^9Ƀpʕ-J[=n[g3碧 zWƥ[w*6f.>p4/[d'0~^D۞soC<_& 'ϐ+ܢ_ria<=]>LIr8NtεdLçzP<0i|hg;e1h'Gs.>=> 3ҳ֜=)ok1C'skҧL9ƴ>KUuE~ ˝ǜɘx'.K,sX6$S{3눋ks;oL:}l -gip?i'ue|ї ?9_2,}deLC_&g^Ƹ:lnp8]׳u9uziOH˵Vxqgr'u(7 r]ğ'm88od{evt8L3CsȜ>>_لm24ʂE6YS8i7;y5M ߹xL첑ӒU>dC[Z!{txL Zׇ7/}0 nHo:Jcgw`Zku^CWPcϨ3@9q]<3G]ۜ=!scW>)ގs+ԸG6n9G ԺAmt9f>\#r1鼊):3߫, <:J!Oot.)Ss[7JM9iսΎs<{}NP?i˳x -=&Vg{YD|cς8~ 9S{9ߏи)S=k=vu>vxFxL}uL[s4-yv>}OYlvN68?pLskǜĮyq޳󼾯ݠP8 >k &ps9]ζ9q[9.)Ӕ9Y\9ϙ|.&]ݾd(i楯jxnϙLɗN 2w!.˟9'n&`_fgܯm(ڶZ.6rg[2LslHm}뜗җowtn?=f*,F~g&L.C9w o˯yΞ7>sXgfG]_88F/?'䇲*o(?Muz&V77؞&Wپ6Ρa9L4G=6>lnyugIerۡUN~x{>GNow߅u9S6g|}f<0{\#్?{,=>TY!_Bx p4oy^c(7BA&>O* oS ..+J^4&[YKۥƷ^׮._9Sܥ`^-KNoTut9##3Mٕ\.Qls9 Ȝ.{ L׹ksr.WjOU8;o/#鸯Z-pytm-sERN;66YѮ`z&WlC3/}.xʃDm|7r<)?yxeKcSh4"?e;Ǩ*LYn̛|m a tP69 ?+}y%A}.XK5ܦtg~{AT?ُ!+N^?N9$.Oq3c_gQg) n $ hs:@?2F,ߩ>of6=.] e\s3)߳%[G鶘;d$wH{ ]AhY>]Y6CSMu߬qq1{vԆ%}Um3)..iI&bJ5/W(|A+ΎL˾qe6zy,ͭ,1&Nʝ|$D}Y~Óٔ5`KURge/fZ['nI b=H6ϙ.e~f}vy+6}^|L&/L9{Ucd ![v<m8~ʝ듏}Zf2;6|O39ԇLG\Co΋!w.NW'WZ6:x&ƶ~hKAo'"R. \j,\+7շrvᨯG]ߥי^n]ǥ[o_-^ `^a姴&c.RgoMƣﲏЗ^oϫh/,49dk]Gg1"-#_&y _dyǽi\ 7y 9A{'''0'I5V9# Ӥ-qlwhޗt N&#>ʌ/p/{Su]j3+U`WmV$iCF.Kg]׋8OJg Vt>n;ؒǻU} 1Or3y@́o; ~6q˥ːC[=kڞοI9;)sZ$?;ѧv8D;OzC?LaP0O ҹO}rX(қ=TO\*𩎿Kw'O-UáNkNzgx6F' ]WKs|{(_ 8ś)8KI'n~㋾@eEqV˷ }TDz,8C]m1N!nz|hZ[yXqV6vwaf2<^{Rg(;CQwof]˵P3YW}vkm^K満plO]½b:~=‹\N9Aj]sǥOpwGC*.ڬ}-gw{?>j'Q&\f\ Sy9YSjwhGD\&>W܍=M>?pdߥʦLe: [SPͬtGN}V3.m'>XE٤5 ! {%5^. ~,- gixt^21>֕3̒>)uqqhOmQ8n'g<ǂP屢à gmgֆTOyqyCmfV-_g3xY}oG_Ru=xzD[y,m"q`yߔ<2Il<ޣޔ;ty2~{)j_5Kr:k$owQ'q7I 8=<{,5Amw^{NGky4ҝ|\=zCrC;NP?;\3ҧC$~Rv[r67 6LxDmJts:̮x~aR_4N#~9ʸVl!ݤe8-G |ʞeK[.\>sOi憇vpbYW%^_M˦eۦXC/S}ݟ;=qCE1A)\3䐲3O*Q"J9;Ws`L£\ddmߔxt\8wQWۜQsK-f]x@pyFb yű2^Ppќ#͝ME/}ܮW߹-J3%,kѤzd׭cY7 a/w{#]úX6sCofhgǒG~Cɵy/Y:~އvQy8M%mt>˸|^lce8y%MU_/s!X}Ә1%\:5˄''㉿OGmWmo[gdCx8OFoms?!pOՎgw.oW+Kw~R4>];)Af} ig$ޱ1q2XSqGaycN?c͓6C剶t1"\fk5!c }Qҟ3_q )}=>M>b=y+Ù錾ibi鯛5\\g{)_yyE[ae(twΓ0}lQs}9+!=_B92\rs=P^_+?o09Ϲg&/Ҽې oᰍ`s;Y$sM=e,+. ־ ~W\ݾlafpئT^GzncU Kϕl@;CL`OCM$ c*\$p2^JV8kw3N$c %icɏ6:T ˾>ou>/Q\z^={ke,4r.}Мfϙ}\dN\?\,POΌ߲̽g640ץl|t~캮NRnڋc_H9r~ѥu.wSle'HˇΚn'_&m)^rorĹ}o003׭L}e;^%23ٙmt.fgm$cv츨TX}nkﳲ9u٤snx=.p|C04g|g>n_ҷ4)#.s9_p^Wl!3g#f0wC3]:1p]G>XesgUZ[L?&eP{VY_(Xйf6rl.i\8a.`!S]WdϞ@6nZkhc朿y:5i 6[{0h׆e&h5äqZ޿6hCosLj6}B 0x]Gs#198! A ţ3C=85_x#:/MpQrbG|,  =sL8g˘"/ ,ryc8}l:N-\kПC˖P[ u$W,g ,],gM]*]>lt6Vyҝ)/:.u&;"( lu1k1'C6ĩd~gPe\grٿ[uлsM񱎱(MoHA;6](cSvKM+C6cl Xǽ~zMs ?l+oe 8~4@0gXM^&v8f܏b@p'gHFHofLJlߐݠP6 gWI ; Lǻc1"n.XKu a<*s9h/T^Mc $Fm uBk'~>x*s'iˍ5q{M;u:hˡp9Q{<12xqػn\@nKc{(j+ugf=mUG?M|icq(+$Ӳ-6}3ʈ0d^8=ǽkS2OƧqo{> wc[̱*Cm7Yznq8dxOg=om{?6z82n-m4a'7%s<;oOҶ>O)wD>/8o>Y̒:%חO^ec#C |H'[fktΓmr=b6~Fd'!8gLwS+ݦ>WNO&YqY{0ܧdzߍC?q}ޘzSKyrP>eroOCslO&Cyiٔ}^3]U_p9$Cxeczh'y8ٖk9%It03C|g?L?}[$uح~Ի3=S;=KW澸OrgvIifwIiWDHI6'HI(H>rH e;F#Faـ#v"${=Uk{H 25Uus{×O0$zخlE3t3w}Bٛ)nAel3=!6{oWgIYZ%g'q_24ېY옻.knC{:> wPtZ:oSS=LH{zQ>,ot&;LGFok6(ҦqX>?=4X{T&(Fcjfd˝5q|e8N7ofm~fҹqgw';i+63=c{"t?>Dg!CmΌHס`$DMOH?aʒXY[Sl,;<הﻗtzd{*D-HǑOrc|`xHK^<{ wNqGÓlF@㈌qܖ|EvJ&ܑ1$/Ȕ0O1=h&"k9n Qj||_o٫$O\#=1)Gt/ÿ;An6g,Y<LWS/.Nwø&Vv-|E5זkg)gu ,;N╹ }fF&9=8<לFdi:{'>$8Dto$'';+u9OYX'9v>{s=\3aaRە2 v6N'vx܎/hKc>c!;${8md嶼ߑ3ɯvҜgmGd|'yl?Y^td}٬$8ȶegȞA(\5n;ۓ첟$Z(Nf&thœP`md6HF'p沒Gɻia뉬'4GҟmOGvpem,l{n>LYz[ie")={-0R_||>ڈ X.D>wX莾w߃SF~>YgJ"wZHC0fe偼u;=5ILҿvlY>rgeV~f-+̲ny?2Ie\qg8Y}W\ge6lvi:I(Mjʴm{lI7K1o벴ߓ,tvqjn{r-8 f s,Y8-xzֶg^^̶Mmd?KI.e[L5INxV.YM'v&RxmkS&$:\ƥp L5Rۧɿۀ}㲌#nbC|M\ωϋkYܫW!!+R$fGTnڄ!!+paaPt!\ȷ%O;‚-%S\Lu1lAHba S<(,[trJZW,K;I ճ̤ ;)'&kE]*m븂\a%H}1G F= B(P8!Pc{,av<ė{&Ԍ; K\DzlEYCp dj w!͂:@Sp!ގny.x-* PQ(shKBQִeC ]ٟ W*^pc 7>B$K48"_@!J+2ː/rfUPH8#[֨b~ˈd?>+V^KX՟Zw*kntj諂9 Iۑ9.BR}[dPJ%'OOK _ϭ̧PCI)e-g5}:HD.e#D.7(`sdg\CCPG.5E*i8rOE>V#4GXKB.ײIJHAR| K8.:3C9"_X:g 3hh)9g=v"SM%Cs+ ~H|@ό(Ԕ&]iRMᘜ&]a&CRfD(k+y3(+`Tr -i+!=˱ry!ԝF)^JnY6JR)BnPRGj#@Ν|^3k"u V#y)KR KU^1KU>LrLdZLm;Zd>SP8HyZSZ#iR_+ kzsuK9Q/RK:dcyNF6yi,H5Ɩ)e'"nQZG>tƴ![(iB9dS8JPs̯'SZBUd1T@T,L}$5-cժ,cRۮTk5hWK/Fa٢W$%)VUX֣PzVOc:da6ɔmͻ@NV-T~R:m))Տlbʵvn2, M//[N98fի:IֳUd5]cӼ@cUk~/ju,H;}SVWdQ4)q~b۰PUL΃H͝iE T6nI=|4׆h#) ,NJ+)RJ؛_!#"MdA{ e.ZYT9&D)5'G+Xi`Hy"%-J<|3]NȯL4m{RRk욆d&__ݔҊɻ&,iZJri'!@2kť _zqTIPt=PkV͎Z?N1oeNjX~x$pneTIq^.{*Q)e IO~I(ҝPӕ0i\Z+sd! ˓6\~ϨTuI*z|2 hq}ZsI1uj-Ctd3tV=,f8'sy{COb"ݡ-tGp1 M(ES7Y|C="+M-\Yjho'֫t }}Kv(Uǵ"I%! VhlYz+jZcl??G{0)M Zdܯ$kƽܩ*zw9O]0 uHh n|"Ogƫw 3Q4æ0~{R u M^fk©KAt-GyZPӧ&]-Y$BPg H=.mU 𬑇"%WiheIrZ[ }k\.MR3?8^J/6(!:'Fh i%JPyf%@e9MU:0":NJ;s#ƽ Ym_M ķh8JZ }6bKҳIʘH#Z D8NV2E`St7D9)+N@j,iΤXɘ$5>0iK%c:wYO2*2w [y^Ycm&˔JTjx Ⱥ3F2{9]EOc0 '(tB60٬ +ѻ3Ѣ'^Ӓ+J ;:q[H^+ Cȿː1 )t"s9Yf2&'?>W@ ]X-y'}g.ʿ~f3/<[{>_?{g_4+g'hz4Vڣo`/se2ÿ׿~_~˯/~{鳟􋟺sx[7olc={3zS|ΞyN:-=xݽKlݻybha~w8xjuӫNp0,,ƭ͛M@- Mj:fBʕ?0wtb,8ƓLYʎCqis֖/Be`x[k0xxǫC-XX_Y?!BFqh{/7L|Сk kg-=Yׇݛ\o\Zݜq[ǟ^xvoY:rVlxw"7~?gN_yta15'SeteD7`f|w1  4 q^NEv4ir^A tlvŁ=p~.e!ꃚoF`Ә|ϸ ڪ](1Pq57al w=яSz|j~jx4_<j.ʒmȓwIϷ㵭ZmSBa0$9 ٛuYB͏vׇ7F7O˹ېEc+_2 ƣQC/>T)sh(̝Ounoތo .~=B|Uǁ ĩ-DFs(Jr͓ݭAqsCO&6uV|q9l\ְ0 $70\׮:Wn[1 t0܀a7ڛk7P@wSEHNrq+n7Tl' /@)-(![<|֚q {B+ԅ97G(fDs'iy(ZzVwIn+?.awonHbJڃs] ^$j^3&AWܢZw}RUa6$qIxIHhxml^b :m-/l<σL5} cWo q4{CwV~  tTii!~(3|`0$u;>$_N|h+gX 0[JšQi8R4]Y- kH2+}Mr?EEefY^QϗZֳ9t0OJ]Su.Z>nnnJѶ\(9! k(7 \]ۘQ`7KmуX@*rJ+$sk+|^"9\gn^ͩ3'IE'-ؖქZh^7tA|To2.PrG67=Rf@Pmf|\sljz-5;' iHH{Z9IyĽE"}Kx{YZͤ^Y}R%ޓdh؛w[{4پ6V_uln6Y' @Qޖ+K=r`@9).q5j5lfM(ylvQ6X _C@=]J5`NYetsmyY?>tCG:W;W:ww;Ot3\5:?<utFsΡFls`vYtuݿv[z6[.@l1tƳfЙk:0:vK\j2ԔzPеRՍ(ZYւUV^.WU#W5w\kEjb[.ei ;wŕ{Cp|;4׮nw^^^~^@l܉V }AE0=/|%ˀ3(p_0S_$y>=O 5 rF"ib,B?^, OʷܟR֋ ,Rp>O~]%lE} 6M 91GnC$AE - 2)q7BZ9޻{7z|.V>QKx$nL6BѴ qOn{؎kE @^+8Q7Je )aAB¼ػ~con{=$' e,x Fv|P"Č$P8ˁ*nhA).F |b8jA䋋` HfDF=(Œ-Q".PM(@[fM\xC*qo< Lۇgܱ+KvśYs&*oUJA Jr~? PoW /bhGTZʑ =ss33%fwwv3ߚj1ZN /=bjyر~0a&3/>,aM @]Fh7bq& j[bjTv̢iZ" 8%TTl@b] L @4 I#C#(A/FX(4]VStBB>`t W o&{e@6RoKMy`3^>icyhp17j$+uVZjQݷ}/>P.O 7ZFjv.7U9R/ YR@4ZZq`%[ yƘOe(1ƩaNRͳw}ʅiɺc?\7bV󃰹T\s ;;5,Q`4"^o bK[ZXBTYK}OjL;̢/e+*ݨ=3[a/3KkʼBXܰ6N4{ašiւџV,} rĩ#ǏW:>PHW Phү}ۊ?UwyVuf躾Rˉb.Tt\'a> _YӔTT<۲Onkg5W*5&\D<H] fDTÓ#tKM'ꭚQnhŒ[Nc8ySٮ_X^~*mB%AuW`]5a̲4@A߹r܃VfeNW3#[Ϊ$fݴR2+T^NJ]3W^jSsv)g̝' p ,cn` N v[}}0~+zhv<=qҎkXN7Z\ԏG.C1 }P<"ös[.aQ_VסC~w+IX=)Y[R߇G_+~BX$vs@oϯa-;{G\,zNP}QߩZ~[~w?>)Z7z򭄾Y(Vaj8^t%odz!0KH+=Iƿ;e0JF'FK uc4y;a^iq|^Nvr#y6<޶jrcvcU"~$t}<;~%\;{šg==_[R͸S2̾N3_ E:*i)?m n-.%izĂg_)W0:>╟ ^`>+rO?s9p3v#ǔc(R1H6Ϗ*gothnY?ksTݘ@=d2O;\~ýj_ɛ3Dlyytc:F_ڲJȇѐl:AR5i1w0S>4":ռ=e-7'm 6]:̊n/ٴ)-U/s9h 49NH`τTI: gȬ[~[߿lViN5O̳ X?s=v9}zOCa7?ӏ|me|yg2_ ř݅b;v.yѿvֱfr+WY+ڋmle`ȧ鳔 /E@5lSZEwcD6:N,mVm.WU'ᄏ_S;ocks/wMȽdRlh%V{x-F"jzK?N^[GY5zf2*NJ&6r$YhHCwՃ梹D\Ys\&ɆAæGڒ%\̳l!M>;+͊PI6u/\#'Nl8x uwq7 K]:-}.yB+zr Kggϫdf#}^\}kXc>9Zrj/jA3DȃI17M>tXY:ꝝ^Zu+]Z%E:Nq5_nҼ}Jjѡ٤7ݤgQ&Ys6i=HLn^ 'zpt:h=+#yNl-,͕.]ZiתCF+=\/!̦RquВzՓE6mߓ}`VW`XW|+lU5] =GP/{Ew&+.A/ AU~muPAzjDOV7kẍr.{Çu? u> B!T4wxcu܉ooa9}Tn#yrQ;UNj.=b5FќE/t;ؐ7}HoPmgvR.&i^u%ٌIوB`yqUYAuzx2{ĩvuمa|:M}i>g~ sQ죓W,,sI/I+"z;o)B~?> ƿ#!B"D!O ap"|7`q_!;"DFOF#lE} k"D!B"D!B"D!B"DwOF!·l%B"D!B!W!B"D!Bp/"D!B"D!B"D!B[(j"Dʭ"D!B"D!B"D=!B"D!B"D!B"D!B"D!B"D!B"D!B"D!B"D!B"1f+go>|3#}>%׃0^09/׋1Q0_Og*O[ap`{\/Gކ\A̳ { ?u,.|ZfpMapsi r׹ggu3T:4>MO4>MO#|m;>}[O? OwoBO=}SWnuo^߽O9x/o7nq̺l1涹i^3gicy0гTm*zg/vk{So^˧>qZ{O>KFWogm.=}s^Λu*=}˕={|;{7y!ܖ|׵g).asMzv\_}Oo{DǛtwm~[ ^un\[nF+ }ݵ}-*{fk[\{;jzߒM"A"3*g괻:G}9%Lp愙yZ9FSc_[9K#dTUg3Gt*<~=EZv m-p=۔_}ms_?zmw]~Sy^*WiKf}n{(x> /^*Fay,S/Kl$y~z)7+Qq蝰of{~+;,S[G::@WaޗIG}ΘQ{Ʊ,ݍysDU{baLpճ-sfw\9xZ{ZRHvGT礣>~j -.R =n;~kku*qx=<}$ߦ5;Wg R&auO}ߏ9G"ٜ 9vF`ykB pڶxa ?dvrÄ%ݳij^3\;A'ջ$+m?GcX$Xaa2& x֩eҩ{F%P#S;s`{^sp~R/[Nj2an wzFFIi1?J-D ^a3ϩ-F*q<*F^szʬY90Q{XCɆ%bkk?FW#*JOs*frwbvpmKR gHXV䮖s*k~Y'*|Ys4&n Dff̄J-PdsJ ]ԕ\ҕO srusWٷ2j廠5ivl[>j_v+w ]JwJoq.ag/wmLf*w2J*^1ԃS'=k&:k+wq/s"ܫa9jLh99`Zv!#fg2 BsT32_pG% R*4fឤS|34~JJ ]Wg!s1)e[~ K?{B땧5*'o̜V)w+?T)w7߃O*^1B2h=<erԭQcr`ʠp~h'x=*o3=rcg>d9ĦɅ,_f.#2Sʩ{'7Ƣ3y (h}<+3_VeL9syJRC9 Xy>LEB㶎 Y%[fJ9+;4XcDŽXp("?߉4h 1lm:,ww@Ե4veFv,;OvbT t+5Y]]-[kw=)ܵp Q:+61Ά殿eWrx^-KZĶfǓ9:u}VnFM]QOkkQ:^gsGCǕXeKݓʵWʌU ]аHd%Vzi-3UB•=畞*zR= v\`Ak7ߕ}h*v<'J ZItD%^CWm$sX׭E꘠2dR4NJx+- qhsXP|l N6 qpXd= +W; ڹlܳƵ֫uTmD.x*_ZFUmSmqBk'4r_|<\t]*g.j kזleb%r9nd6?: 2vZpBmy eT4h^#k\O3GWPtĵh)7uvcJM,H5s^gߛ樄Wpu:;wSqu½̥c(rRdwRdQGIK}0z.W=X/y0+ry ̢f*oϪJƔ偼a?19QCOiO#,|.Ơad4#qna4.$K05V_"-=_ګr\&u`gt|l٩[c\;Y+5Ηio< }6m@oM<:7\?,@VOW*`ER5!Ԝ"x̽ԗA]ȱrZ̷rګPk # F4-zW1VRCoHGeÞdba-<:c4J>gI[f֜\%Jk6G.OXVnY1Čdжoj ŒGT:ȇzzWҏ:]:W( = "{{Țlf%W!< r5KcUT>Ԕ=Ƃw<-'jw[EʣHR4!׫(~kU)I BYuèY3!B1 7F3aY0FH fD\Wkjd?JqOmԗuvd2j;:8-A+|Stng~ë Vΰ/Y 4k{t/= ZUˠ$,0?Ms]<^2hkyrcw ەF\m\e;9p>zW*&ïo 9ǟATjP"R$ɼ wrLH|Z{^P5Sy]5y7y 5Z eZTGW}y`rhʂ6JNpPytKηxst/̼urlRkHc46G)-y^S4 =cfu?X)%6?ۼ=\1 ^S]rYQ%Z3tgWF6v':wv0P`15)SYba'vT Le~;i1X =%>xllx[lr)JT!TI;;H]@m$ɣ<D858;P ,|VÐy*w |=18q6K=g?V8-<*d2_% \v1qk׬rx]+lc7ǔw%RquNQ"+Հy]ɌfK!aȑ DE;NG&C8v$Uӵn22qLs:5+Y.d&s);zyJ]dEk^b+@} Yw3gpQ$dN|\$q05N\v~ZX= XSToZe |cyKT%qTX<^?co"VY,pc5 |Qę@b֯+vrƿ>a~o bIdekj4%|} c%[K"QWa`6^yZ"?̵:vR4Nfv&\X0yk W"nn,o0~M#g,܍sP#ȱuV{jͦ{hpVÞ)]>G`d4S<J k%-ď'' dZS/sgwgڑE霨O txo<(讞q&f> ?\ bWN\|۹3Δ]԰wT3*peYCm3|=8EnhΒ3Xűb9e"և}ىpfy#Sz48>'pbώY]ȣ לr彴Afn wD_K&C8j]=,S=?lA˙!ωiXxĹvb%z{>BsSW1|2rfx ,z.ZFU>Mų MYӴ1x`/?=.n>6Lp5NoUFWؐ%)EߑU}Wb'\|sqVIJێ+I-shi33xK7hYfbj`W5(e ZTS!>vLgqv3ƈ՞xGvq 'x o E43ǜS]`8X2XNKDcj r/yΟ!;U~,+ ]Stq8cWN֎]Rt\)*u@V9] NT%>Ĺ8tx/X- *$[!qDX FFߊ˲ \xsYAԲ{Vޛ)HS[;~jR}aZ샬$Bzg̈́JpcK=K5OxǻqB A6n׃%L 'OȲk}Y_VO ^C[|l]Xd`hbrOIx5Cr4 _Vuohmaqb {"Ằdt-<,H VApYjR$ ZI^.̍Y}o(U)½A cr?:]30߱H]"照=);FzH7s4ӗG{xւw݉ޞagtP/ل2o#Js xXKH/0p=P!>(,a~tǗ|N!DNߗ{sg]&DRtS֧;'YDBkcdP&^/Қ1_MP=yNieEAIdsiaףv2rLc(ݳ3l\+C3LYDfԩe쭹R[dPi^@TV[9ADGtJt_TtF7֣~J8V[vк>|^C,|/cVVMm]'N{6`Ysv.OjkbWF嬼޾4}7y]P0f\TuK NwϞ SMaXG:&ĮPAD6֨n 3@t  AHTMhYj7&}HM)w|1k1&4#E]6pFmDuAz>[PC 4x gj u*4<\QLdM=8UG6:QsxgEI[̼)1Mm`z1} {]ؠ|*Ǯ+[ݢΩ3:EuJg'Իw#9ttuqWMO&v Q ~TGW>RC\sS#tU+S#WAjU >wP \H8m&]tlْӒpw4q]ל\;h jI]cݴx/݀l˨2g;U! m*mLvW.IK-cjr"dxNJ3zrQ_>2Qԏ"[y 4\޺XyNFed|M- &L-IS> v*AY9J.jR]O8nӎjKz:V [A'y[oέ əQ)ƓUKH =nVz6^+4YoII\EIN \;##smyEd( 6[/ШMNeٚm`VYOǭ308焸.5-}e&mIr8$ITP|i!|+7r8MQQ:[B4$4Na&6苊reKF\6 6$zpE &C)1#YjHp<F1L:AO7-<ʹ7ϭMTL`3BFnj@c * SmK Z (u: ؒ^d,z7}z'g.́ ە*jn*"b*{UFΔS\SN1Cz$jR[ YvGO%"zF^D2S XOfgFyE$MR1o7~^>XVWK'u]p6!u=2C(ӛG~uB^3'|7\MYE^bUԁ6FF$pv:'z}WD92Qjͮo[*"K*JUUU?Y..-$?}V9/ J49e]-YԚ*Q;:nF ak;y]He3 vA},CºMs?ϟq@k^Or]ZT]=[^瑷߄5OL>X U>q {5;/ۼ4NC]WEC;7Ng{(h)fR:s-6Q[D"<8&Xs:L3M^ YR3`4Yq"*ux M$ tD犵53i~|>#DE^!Vp7]iE_*|VώNW'JEʻ>͉6?f.5ES-nA71e[{Gym3<$煭2wm]]]XoԎx\}ϑ.01ŧJͲٕpNk8W6\m}~>g܉*/'sA=@]k=ou*%| Y~{l>M_VuX~ry|^g2^qk;#P5Psȉ$F6+\UZ_H!}߹Vf[uù6}Gok[G1Ӛb2oCy^Yus?e_V|+Zإp| vOI b-QUcb;b,J@kR] MJAy-2y+m˺WRRc.!ebjAE؀CѶ[Mpr,4Е-DQp|Pgț_eevܳE Pd!؁S0OԕUi3WJM%qaM܂j5S z=ވV# ثF>y;oehu|3$'?%68'K 16@n{Ql8LN}i]owWL.sIN6"6F_u 7}YG"cTQ?;/QoCq}P'OA>/^գσc^KtmXuڨM&tkjfUsw< shxXE௒&O&sX ^6Jhio͕2uZ+?T]?;e96_lk2:q⮴Z'@YG'EI Ṱ#cIUeR yC.܉öС]Gq1yCn+9YóOTzZ3LWo&$+E ި@_p]F40yBqFre? Etl8aco^kg݆`^kńclc ) ?ubd;F(tj^27OlkhqV$ *:;tgʈRt<<CRwkʬ0#AfO|ٖaNM_*ېNXMYc%Y=?3ռv:(څq2BNV=:%5[n;jYzE5qbskmUȴ!e{^@68:q@ja{.uE:/LN`s;񔹶?@8*qj eWGFP@*R5U:},#D2HƲUُieL(AyR芴O(J{FY3SJ*]2s_[KYޕ{)\{YHs^3ԖzOʕ%MD0~~'=S]9_{i'"2NmG -eoBQ;mYIiNsZ䉩\m-kDİ{_h Rht?]o27eh>E'1봐y8EeWgrJkӿ=PeJRGPE۽2U3{5GqqJۚirj].?}^:ٽ,x=[SMQymӝW- n#ޥnK|*{=.@|uom>sp6w^Y5Lu'p8y+OUvbRIFI\xeT=)fu1pB6F~@-Hd\#G7pl#;_NmYd!I.:F>?ZxrJ3voH4o?jU?q[>$8UZ||sswӎsli㨻id>ձ{kێ݌wfGoWA{3.{}gig{^|!{=xK%qϳGeJ'/ڋhG7,4v$2 UVtG8`\.Q2y:$nUtLZ+/U&A9{IF4|qf +C!#\={_G<bkU^yF|EUۆ-Ev8Q?Ոba\0ʼ2bW{~GQ۩mw x8S4W >"#Ɯ^9dQwĵpj6AelQLOc:T<+uI.I .\YZc&smMZ-!969%mʳ&O<|Vڶ1͖E<Ūk hijP4 @o42QMQ4=:gmCy6ooD΍S;. _ }jԪN)9OD Q|(s358}N|)-elwSo&pF^+2 V*,NȐ5xdl[<=Yg"QMT (Cʦ`Y+yJ ~PF+cFZ#?s%]k{L6-(Έkιx:IUy5毉1a;peVZ:oyDUi|2| -ԗ;g;bXӑ*hW3c΅CȽ&$-x$s7Spƹ/$xvHtM~Ud؊Z)fW:h7gt&NsݕU&K\pYEғʼr2=6a"wۂa=/RiXUX1F9{I6fn֒!&Tد_ˎ̤ⴲ׻}=sTj,w`oO-\<읳+jGѪU$8.{Grk3 Up3uVhi%B+|fhel.DuzǶcӗ^j#+2Qt1>d~1 ͏NUIxD)tk@s6ts?ƈ~+_8Z~#/yw_FN~.;m8ZUz̹fZטj#_8z&ݭ3*3wy|ӡ3%6k')R}kѯ 4:4q?gʟX H^زv!!O8S3~T>:fm›)Їe ZT.#˒^{"X]dbJ5W{|/2|g}kԓƒy6wԦ~34seVM#fiod#HEhFmu sG\Su@ǖ)o?іK(u#c/ ksrSy ^eΝ镹R#"c|;u'n(1}D6, FRt6r|EףR[F8\LM;C:V+o^:- AQ^py_GV8ҰS.n; k[;BN+)VV&4|Si ӽ.Y,&=_c]{z^Wc;8O%n#fxr+˚*~%_α![Z:.ZXH:}̾ҚwFv؈M 7^_+A19v!WhL_&Z@3Ԕ\gv#$~5՗vK}>*<_Ub8yI^1&֥&{n@׶7*m]f4%'Z!':*W]\IJS\-E*v5VCE과5$Ro’]T_J_|62Zr]ݕBb{>y/N6wm~y%Uy'?@]>bIW\eۉfptޯ;+wR>UY+JgWg5VZX'଴񯬦(A{=)7 I5{i~ܫS|=wv sc*VqW]Z瘏!fcN!+&=7DK]活 V\j'8Q-3Ů⛼*u2M( }fgi⧋k樂oz՛z7R{-_^k?7سƫW޲ͫ[_x6^no6nL,ƫkvc-vW-vk}iqn3}Xo8Ӈ~|wyxo?}{{x8|?:Ozß~/~^{_^w/~w~=_?ᯎ߾8>bqV[[GkOzŧgo\|n9M/.hO[Xް77˻w3-,g.\>h߼|h=|x=k{p+-_g-_>nYqF{x {w#/?lߺۖ]~ܞO/?m/Z~vY{ /K_Z~^׮_i/vϵ{컯w=>qOgaW#,UQ]|l?.>?/e[?'k|~:<}y8}8OyLcˏxgK/gƵ> stream x}nE3\o>@|,;bI>uKH$nbUX.e?>.xt|{wxv|tr{waǷw/޽;]} ~{zq:7ۻ/>.继vy)_OL}_x8 ˙󷇫ݗŻm?OuxH϶Ͷ;Htov[m{~rhY[z͛$~56oz@iHMpcRgףJqҒmdWDRE智CA։$i%含P$ H^5˚G(PeaLфZysTdl1۫M~wyyEf*2>e:iCz}BҙH:S'_X+NSqؗy~ @b<,yQ%(k,h,k,hX(7 9Ktx;b$CTE3@-է}VOV,Ƽ:3d2bͳ5i^f=&Dia'9vȤ~[鲽"zϜPouBs뢨X}.MdEVyQ*~DF|m&yJgCg]DxVvYЙ( 11,46Q@rXIlvq,w7T%G\ӬL]Xa+{z?)"^ ;$yx^HP`3+=DUD:F.  a@2c{z"aCCdP0%ِLX_0& J"LQNUDtodtBHdig@.,".IR BT8tNqF&NGmq +{k0kh$j"bȗ/&|ŝDڭn[QQi[֛܏5]:_fۖ)eJ=jdSd4 ,XS%c'cLG,bHĢľ-`@Դif~k7&wH2Irrb$ʆיVnP`7>Z-vs>b|=2^EcQc4#)k{ֈ3;gn5Յ/· 4hI4EhT845wh{3m5 .B;փa6HB׃|WYh/pq>m·ua%q?( YE>E|M|f:%i;+rԼ/_A~x{S)+/w_SYǿ endstream endobj 318 0 obj <> stream x̝[muϷo/8=u8NsRAZa7$% ER*TҊ J**!*Q!DК5oX;O>^ s]ۣ|O0:goĿk=>/xQ5~Q+w?үQ۟߸;JW_W~څQ?ڗ_??Ҿkm}v^o>}wF^z_|3{}O/^mZO_IK/7Z_/'iT~- j?_>W~{wѴVFϽR/?kV~^}2j{w?MPqh5zbWڛ~Ps7FƣWF*x۶+G?s'=;8aT˅P91*D+Tj˺-(-x7qWFW2o2Q><ٖ7G>M[k˅-;mZp/FnxBMm Wcbн QjKm'qq'1X++[L[44<mT[nN[L[V((߬mw;2 xyn~2hzc[Ֆg%o;򦸿sLؖ϶϶Cmy-?ږ]6mLԽ'>o OE;1KѶh}0>x{42R.GJQmձ|:wBAǢ#c1Gĸ>+_J[vcn+*ի<ܖiZ:lK僶|!o˓ϗoѠ(/Ur${^i/~(W- Kva[m{=߳yVnGrYeR((OŜ~:Wm˯D_yKqh_uW˙'T6bɪ*U_ z?~է.&U~ *Ѷ}:'x6Jx>RԟFyw|ygx{1qL|017؞vOEG|˛އcc~,]Qހ"y"xX%滎?[}ч׏[-r;bUk,c1ʏ/|X:{$~qϖ3{XQ㉠QOF^̓1U7BUXz[~*_/}z| ʽC [drɘ*?S)TXcҪrf4HxwhSis[ƽd47bwc>~X~ŮU>|.iPeSqsՋ* ~?t1㛃ٗj|⺽wK'nէ3XkmŶװmFݚX'^=[(։g'W*Z Yixo偨D_\XykW5 qջ끧֏J-C<Yލ/^gqF[ 4_V%Һh}H?2r3J+j*JN^\cuSvtS̩iEY_F8*pOb/ٙ}2Ƹ^h zvsY`F󥹚|D|\i鏳,}~籵XuV$ Xcܳ>A~&/K/+7G;8geٹ?&/J9ޱxx/p9߄O(3C!nr9?!grs79~¦ux<0)}"IӁ؇'vٳn9zj2%Ǵ]crN Aލ9Ɂlƞ'C4ll,󁶮3^fgxF:3\629 Wf!^;!~l ోbš}ǥ;ku򐊟|Ҵlƿ忮3]kC_KM1> o]S)_^cUnJBDG~b#KQۦt5Kk9kW7,1-|$ KEu d{Yskhʌƿ»;凪ވ9xKW_.MK^j\ɞkK{Ľ1*^n[W8GFIԟvh^}Uz^_ZN<9ZZ? dp'x']>=Q?[/ .nw%wgx񩝮8blm Hw/[׭g-#.W8>O/jnjyN͕QWm)x*Q98 h6ʑQ(sySb(>1T^jF﫿}(Y޽U:9_++9\cҷsf<#0xLW་WҷԊg$3-sq㈧JFb:3ґY hOfW{bߣ־U.ץ?ٓڶQj7FѠn^8T˥C:.+Fh#D{=ġX(.?O}`/{1-m~LuGq]`Z.NdvB[P<;.D1lIl⛊4:#ԉ&Ԡ~͍ZCnU:yt2&آW\x'G|xD?@ ^`n6iͷDŧ\/I9\νߧp(ķ]gm[bg,ߌףJҝͿVup(Z7WV4CY0/h-\%g7Ӛc gNkEX;|`^Xﶃ3m+pZl}Of[\jn򥾟o88,~NuWkXϹK#8C?5q>Ӳ9N4E2(_]ҧAG. Mi^k~^I;vf/֟rpNe_+U MX.cndhVYf{wBQz@1Ipx-BwXܻpi="\:cu3jͭ|tF_.ݺ69\EZq}j{K_^D>x^t1.&9}ʴfipih$nlpe7Ufz]winH~ql\^;C8$5.[)6|8=>nj#n z.S6e\w3{LɭJ>m~J_Y̑<%kg l&ǒGٜg4eds"z|_>rѿ:ِR+}vcݸmN6&"Ccx}$n/V(c 1|cY鏕wBZ3*Վo6.vJy>Q̾(9ƥoC&5(o;.] KkGʍ1ҳƢ=dsk]rj˼+z3WY۞x|h;śNr_{77.ƙt9P؂)>/i=e\:^p/W<- ɻhZޝN#d.Yd2,]mi(9,O#,DHg- p8•BZ5ɼdF:K. cj+'+yJskK~ { lW |.n =U5+@*USw<KWцgHۆw +<鼚,5ۘʅ9];ꯗ>o<΋Hs% $sUՖt-LX9:K_',PV:Mn&u @}g?"qeY^|y!?#Mr .a61o,ݚIȾ;fdt3'W` $?*O(!:簏IJ`%_~B:s| L-p) {\LtIq%%bW,)zx&B<սh]\JY{!T'{<)D>qH;.zǘlj(9e\l\;1^e| =֥ mMWg*}ڹ)^1/a{7K_m;6mgE܋3vO,§{^8k]g)өSAha|3ǥOk Lܳ9f_\CVkM/نz;G%\Q69g΁>U([cɦb Jylr:Ku4<*.!/ w K3ĥtx([W|^'mI4.}ԟY_$~tI])_:"9důG ʢ+rSe0'DީmxX:[OxGMIԘ( ,;5FAr>nK)wsB_,]sd;+[z~OK?_u$gZIEOүKTl\} c)/hJ_NaF{Z?ω=ކx@LO!{WEbaݏ3/xy{Ʒ+}uq=k04Oey`>1Lw%b{z;eSk-qo`ՇOV30O'rsi|~# ;9;1N]p'Y5犱:mH7q%~g0vrq0u / A[+: {ۉv=;>O2=/~senY2ɢ˘󛝇XYLμquxp(gksҞk={< ,iO O6ޡPnd?y2?ӁO21q!q졹6pgi߇<ˑ9|.}γ 2eh l,{qnvνjse#[%쟍}Ȇ6 !AC>=o29[_ѓaHݐz?u6~c{zjϽh~k=ƜQgށrByf9)g{$C|u1$Ǯ6}RFVqyxҏ}³sV|,Oi[tΉ˪Ibu]Of2[ȵEVP{tyB7|m\-;s2AuN}HrW?}깄GKRy5nRtfW!Yxu3{q}C.qB\YS6 nrҪ{Y yg: y^pg$x<%کg.45pw<Д./.8OϥMOdV Ӕ>l*;&]Eْ<sH$+Y^Jzs*٨zD9۫yN v{r_%LJ?qt6D6 ,}x#~ʵӖg[z 1 M>ϼ%ӕ_Gq s>,~sn);qS<6']s{<{| |O/.247hZ|LUl p~x֎9/ lj]3|gy}_Ax!q(W||Mzrms*?qs\Sg)[sr3\M޻,}dQӆK_ܞ3/ye32B\×]<?sN&;Mdθ_# Qmn]6m.ϜdO}60<˿qp^&NsegU2OQ~rLnn=_M>8}lCs1-üsi6{l8}xƛ8Ʒ4ӥCF*}{35F,I'8% ksJ>mHZ3y`F6cX{|26>GC~1?WzB8yͼ=~ΟviE{V6ip0^c6lHsY =N[} y6i z9^ڜYnj#4 ]q_#x\@u2e>onw_Թ9/nN%X|yD]S~..ƦNi^[+OE~v;VQuU>$ԙ7(7@^ls8!}QVJ^']NknMκ0(ԯ~M3.YCW4Z#sH9(]f|yn!~SH~u3e~d6YԗS}.Sn!mlm{\|+ʸh}#'fRg)>Km1wIsVxeR5Ѳ.}XmQzYIc-%>c7ͩ eK42fR\()\ҰsMŔkJ_h'|P2_{;^~+l7J?Wh}*yOlTcYL9[ X<'2)cM$;H&06>')kNmikI+μ^J'2>'~O>7Ks;zέۑl3]LW6ǕKmpo%g'86EL8/\7_̡yH|+A74?x>=#6{Ȯrüp21pܑ3{zk= feqp"jkGYO !:pWvG?N \yO| s45- ǒ@懩C5]ϑ 3x#p;'Fevl !fs(ߩ7ߜCr\ѯNJ_&muL.m3ЖvN E\esXVvoJo{}' #Q_K=ttK3݀utg?K޾V1;^h}+J=47JåOiMȿN?5]OpGe/ʳ1ߞW2A_Y'ӣisֺnK/b E[G?Le1Ɋx{WӲf or-yO1O2N`N6Y[_ksFIY[F<:_/LfYG|/Y_^f*VᡠFI\k}=\Ά7C1 q<ξ7w(/}vd%c w='V= bPW0g Θ3,wl^Ey{WJ!{(P;=-=stwwSD?I0$zwOpv/ԟ#`,sP7{".5SbO0ğZ)C֞dEϞ@mvNʉ9h;?48QA^p7Soq0>Oj#}l ϭЗoϙ5̏euYLq24b@Oy:{1sZW|Cz|= :䓯jl= ˅'ex6Qv3ף,'8=tqNkߧ.f\ Cy?ڊ{{Ͻhauiy9̀oa\41ã z4d!?p& ,̆l+jNP|{cmԽ|g7T2p ",q\,kHnjtY*GCCy$bn8t+\494 udq}8^뻌{Ũu74{J}ſ`rZ_7պB,K`>2 UC]83#YQ(7r[R=WJN}N'LEl3Fs!me{znMO}'{-|V}C<ɾKq9 [M ua~乧[&Y@a[,gh9*;\#N8|&-޿~IkCC>JNk6\hKvYR?[v=:Ӿ@dbbmi|­+mg %}S0hE"VqN0py{'ӷcEA!2[_ ά ;4̬n[0g83+ގ^zBe$YV?D P8)ydl%9.xG)wd6S=Ծj6,t;yIO0[opzyXj>5;T h;xΏ"83xOf;~SJ}T{~>䆸w .v~ k+7f.YOxIŧln8jYlʙ9q瞯uܙ]ähG^Y=sq#?#BI>p?n[J2 w_:Cd11=cK"su9& \ek ONۮn 3ۊ߶is-.q&O ތxs~"3Cv<FT;]D+ȯl;.}9W~ θIc=c en6l !%Mױ&}9~ʑ6'mʓmysbDVZkB?gZ;[R&WI)z|}$z.}W3}ӞR_7k.n%?S|u=",|ÜP28g'a<͵~ٔʣrW0C:o1zr&| IԁLwe$tIyT2vf|;K$gLG29`d9{g=Hcugc8?)}Ʊ«<뷘&eLʦ?lP* sl ֵ>w\p\oC*F>dɞ= Ƶ=lݴn ^?49tj8d3& m7*oaЮ xr ^6Nwycl]˳qY|8Mp&YkI㴲ymІ:?t 9&m?0ua n?FvyM/duHw^/`gGB6c&CTʁlh͛}b0 sqiC fI;?Gg{pknGtNK_ףmig]Xz澟ǫ qؗ1E^"MYLyd;#l+8W<[|>ptv[8֜?ۿ-AH.YOyAX Tξ\|~Yl;S:_t\LJwEw&wq>Jth/Av-ZWbVk;!Xz7^Ҧ3n!O4VfdX$Ӛz'G/~>Xg *,~<^Um9nhog'>g=u/~KV;q.PiZ[X+tZW {za!}>r#t.2%_?ql0m@K?ɧ] Hia실az#eNzN|E(N7oFmzfөgw;iΓ+63]{|p??g!Cm@ _`DMO[ ?&ʴXH[}d,;!M$Ch38 ! }rGڥrz"j?EIjp#FNnzv18֢xn=hVk(׭^2׈=B]ҳ|t>ZI:{]&=G7:EL>Yg Y;`D߁OAg@ܽ]u1=Mtӿv$v|B ͏[WeGQr&MET^JQ>:Tйlٜt=K$wE/[tlfhdSTnvhQy1] FgK0v iIQx(`73wD\nQێzѾz16,U麨>m"yV7=M>FQ7]'Gu7fXn}vn6zԮkTNntB UWgE>OK.OA'M憎&e$?ꗤ6 tO >)oH`v(I`s>dߔmjquN:IKF:EzT>g#247µ⧛M}]OfSGоswۤu;(|-JG|b۸6'~' r!GTTP~VpO W&~m'SL5uҲu~ ݻ! 3tevt a:;Eڏ=,27)]qpO*H([RqG KpFu3DXԤ=mNe{4ЍWH{QmI]k-] ar$/yoԟB}dr(4Ly$1Q6rˣjRYA}~(Q9Beiߧuy~ ح,/!/Q`eky!v;li7=l{ϲf$sX!ރrn.y,<ŅmkMAt[A~ztN%ᙅ $IJ~J[N|E{A:ԕ\$ B­eP %'VOWI O̧ͭPB)1%g$d}@HeS\HHIKf`8$?`R{Ȕ N/UwMQs,Rx2B %R0.܎:U39_X8g3i+c+)٠gl5V CdM)S 2 TT#񀞒jfG)Ei))&4[Hەē,Đ>,p H, rկY(Vzc@ ,Rж Rwz!EOz|$6g.\*BI$o _Ðk}450K)K_84Q <˨ $R=|՝%u-h[@B+2<#IJ(R(9%G!}}4xg0'I0@9娲hE`d\z`z`4I){օ)cIeD$1Lj>%.WFJ4 )W4>r;YL-S:v3= u<.]ZE\/}йZ:Q,7+ w vOKu2(a.IB攦JbA-'(T!7ywI $p۬%)% ,>*etWrhSK(i%.pu-{Ү1G3^(*i-qH$`g Я4.zeRBk 횂D&m_O_ݤҒ3QY֣:jIIHH, ^G+?.@_ҋZRJ\{ᎀ\rvIwxt+u]_NAwDNRI+.!6@ ak吧/)ӹ#> r“_tebN,{JRc.C9Ipp?gN<$bY> 4X :6ssax:jΙ:+X{&T@9 A{V[^' 1PЖqCS8QJQԢ,:~=8,+p]Z&jN+W8O,5 e!Q+kEJCI,Vmn.–fX[56 yʻ3_ i H"~U;Xۜ靰NUUfx~IΟӑr KvZ 8f0E`Sx7HTSf_;A͖ 1JV$ ƜRCC&\ ԑxt'p6J!cRDѝ/!REgVɎ;kecE*5<ƝOh]CB=pEWa0 G(xB60ڬ+һ3ҢG^ӂ+`b%L*nS`h/aŘ_EHwDD?qƺ'_/bwi95 mZZ{ڣj?~T{Z{%vyl:P{=^-aC3b\^˅@yY|=T^/뉺]o//s\,w/o.ߏcccgicױg:{U_g??~bh>k^o^Q\8||=ށ 8|ydž*oN*?:92{>G^x^z9ҫWG ;&jkc}s`{x{EطWcXh-_/Wr+ _޹~aBhbm˩WNԯO|Sy+?[I'/3Y.~WOoN/NgN>=u'?܍''>O{_}_ط}}`޿c,>o_jڛ0A (k7U;$]յ/aМO B3<:{o$A.H ;TJZF???ɮ?_KY/o[W__M_|3t`Wq#ae؆cǎFHi. 2F]ͮa9v1Fe7ۍ"d !c(uv'^;Wٿ6ҘgKX%^ i2i+1} !;wi~^Or#Qggf=<{UGf;ovozkg~ oqٛgou޷{Sw=A!}H>t?=Ƿ?wz7fk>z+:8s`zmW߷w[wڹmol[.|E*Tw eKټlJlhzKj^>Qٲ}bJeX-Qf0c7k񺼉-;[.3Q87EY/є޹+zמ=ƫw^-[q>vYS@zmcSccB*rpRAburgnv#o:?O5$arqbkgD N3O]jj`4Iݴ( 165YǞZN[]\.9 cV׷rߑN'mWON[t˨/l=>b-[e!1qLUCѴ+ y)VDto sT7%=}s⪔NJ`ۀ-Be>Fi*#ueg ISk%Jhud#(2:vrkG H RTe8 +^U T+4zxscɥF~~nfT€ID0Ѵs"^4&d[FI1i 3*i4יfeCFu]r.uIL|<>37'DPY::%ͻ8(D@)Vsy~K3}ͷf4D۩I:W٪[ەt&ljҷvYrl_bz>v67۷m{[ڝo+qgڳwb^>:| tƃm|b?:y#kFPa|j7ޤ50pZ05}eo|pk5".'}RL@̇2^i~+7tym9%BKys'V7$T~/Egmpl嘀s%O%&S~;gsإ^H%x+4ayٛXRSVb!nxߓPi^{thyY ՛^d-/ӵRۼh2U5ѳVKTGVc}G Gө#ח0&>]pO@2l\k\2OKKubrC[S$6jU:ZӔsU_SFٸa4q#6(>14+y kaO>zL>_`BtncqZξ|?9 @Ō4"+T ﰭ1?]xMgn7FkG#dy`hyHt;Io Zv]&#V@*E퍵9Gʪ5kMd^50}qJg6*فqˍ;Qfpx M LsMB3q#9\aqclvX#㻀皞Wң0<,cޜCΪYR=z֒#gG{j~#oF7]v:'QUK~מ#av!qs8bq׎Kz,3w;O$ѓ]# dazLxp >!+8\=~=8`ri-YZGVh+N\3vX`7K#Y=ž* {&>A} OCpF~^H->۪ ӳK Ws{lK?ƟHD+a{|N)?i#11zi,ۇۿe/Y늷ݝ0[,b"4KM'%wrcq#ѰW?*n]f<3ؿ1ƪgVX?O^ϓؘ_a|8x0~80qna'_\NVSp j 94lko(שּׁ̬zWS+JZIHZ Y0F8c;;|6gs|,@{q_/gzvj{z2nQ{BTesCCi{騾UZ ϯZA*hi>?~'S,pK< e}0Ùe` B0fMX/qxS ؅X8ʊV`B"_rY*߄(cxRKĿ)xJ 9=ǟ)Dg+p䯴ZY/- !9MKZkE['2ޛ/Ty|`+9ņ)i]L>:ݒX\0S620?Cp]yp8 JAhx&Oїɧ$;̒O}zeE HՔʗ1/R,\V!2 _`/,KMoCHj[86.#Z^8@"ѹ],=vRZOq`pqɧv:4Iu_(7iC u15<5#aۆɘY$*lQ4I)Y\)0o5L/`.1O X pź;4$r*%e0.)<λ89A'أ{ Qk}k_|[*`l:j<0 DŀĂc8rYP1eP=D@PW~M~>SjJBQR0ucRؤcaBN!^_&?h`~|mM썶E1?Ó?IGrxr64$M{0̢^ןh_NRi&݊r1hlLl}r jb` mӉ={cP aBE-Keֱvh/2>YĦiƷڃX1Npu6ykW 8.t]mc kńyQ`NۤXkvn3W1C7h^/ ;JlaKi@:pHC1D{uE@zu8+'ahC+nV'V/lka3;V2Ʈ0 hTT+]UL ]EdL0 aw~ jdzo33V !s@ywnZ9w?T>mCu"\Ӌ@4bDA>gD!~uS=ʟ@9,2^LqrV&x$<tͧ4_j]Lg51u  t[w|67˯+:s: ~Ĩ׍嫖Dp,XoC1]f&zWE{eu"c}&*yZ (t}5E;FȔ' L,+ cAPkJ@k3EAβh1l! ES1nJ N8CTC8wvtnli%Z F!-Ra#eQ7@%l7.^u6YXQ\KfpsŕtF/cIۀL -z ߲쪃$1&FNJ5 @.DdϫN3~h8׍pPM>O =NOsM`ű],oY)W#{Q>˃A(HXNpD"2h4h@H{FyiX/djPIhuf0ʘ5!ʸ8) ݣhАGcDuPIL?Zr_詭3VJ YK_(;PI&)R$'qƖOF)i\jna^ߴ5 {ɑfn^1j'}b-c;IXL/BqX`ӷl5cn@Z! ̨ .[gzRUn,ɤ;=lYMhp9:ʲNу;@i!u$ZR +`Ѭm۾(5i' #*bJ4#O`-aZ*mA5y>Wև֜Qm3cYNp-OTUn:mEjCZ2w|^ØiFM!XxsFfTN ~߂ oAT# rFO6diuQifcp@oMik)i]ÉITMLCqvR-?a;)ciĵ>bWS+0E[~A!'O⑲KDQt~RSTXgQ\2Τ&sß>dQIh ˖jzgj]u8 !_o'| IpH!Nו6cEYwUln8tPm y509A$4q[ ֜0z}]ͲvlKDmZIaWV8dc;a  CTz[ͅ hjrTqP *]5m4 *B_TGr .^qV v 1{Mscd p`}Cc||姼\ֺ*M3VRŵZD紈ٌS4d>7cv2]r'\HA9_}Q)ˢ("Xsmӑ*N3)k!3e;cn)'(H<݈سȶA:ɠXF=`>,rU"D^>{ryp|x\\IB2[_$*1+$++s2Ռu+A-{A-`ߢ]O5"˖Iثr;Aռm鼜.bh,cAN7ܶOPwLSDMδmR&ԟBbtr^#AkKج{Jŋθs?fݝo t1I3jB?=ʲ ?T챡á]OGym(r[q"EzQt a T\mNd= fٯ\_qr`OC-P/ȝcNg|Rd2.Z){ 3>ڃ70׆zFj5Z䁺 zQkMS( <Z&CE˓5dUoe}\.'5];h-Tkg#g}x"( ~X)%§K\lnB0I˻A<9YZM|4#% X^QgO$\|nBb|pP^eg_Bu ~ D"J W@WʶѴ1ˍ qUIDGbS<(ѥn݇._Ɔܷubtbմ]%4gYLЖq?hT1Ѿ$aL7Ĝ, d~âQMlWX E^WP"[C;'950,ȕ-jmM<cX.1+zQ;(|x*}V6"2Qa޼6ضZʐcR~8Rnu}r᧢RvBL Yu.%%g{;+M~nYNh꺺%9Ktl80YZk@5F*+.Aѽzp@Y0D(0[bS#7BA횢cV*>Z1VW7w6X1kH κA dNJ/j\'0Ix5>@9$;C'93]ǤmEx:Aٌ\iqjA&P[k-{};$ҕ)H WM<հu5]n"&63\,V״>ЭYT!W*  IE F|[bt:l3ɼ$tdT{W-NE?/*6pb$΢f~uYF}w7M0qMU˗6Zv>@cU`C20[u͏,-&IK4G\Bm/Z:PBo# o=|?Ο-oͷPicP#ՒMXˑF2~Rڈ2UDeE0Z-DTdˎJtU`*TEfa;Dj]՗v*"|WWE!4b7;i;}LgU's̲In$Vǎ(7Xt$cSx+t X"^oyv;P7ȣu7=Q{`3O5FNj?E a+=ÜlUDɍ E5.=\EFL|2}[ {v*B F7X]Ĵi0SĿ?šptfZX'OWbF-ʣʛBb{Gvy䑝˷߾3:q>g+Ebv0$["v 'va yc?a=f<Ѳ TUYP1/ 3L {Ťƽ]SW׵L,e 4/L^+^zsB 9yFp)DZOn,8_cqe˯'N1G2]/2uzm4NoV;ǖŀA1ЀiH;k3~sej{Z)G|T(B$_=C%Pc A{-yˡiDnm|_䆚f|xnKQ|NmQϰmx ?iaݿ$<3[d~KXqverytRX7+A=v[Ak'Pv(Lf^of AX,T\*ǨO:YjF.qG8l%?y-URw;֒]@}l]$9{tQ٭֑Ei~|E7ےݘ+NW59kABR35€DjE-r,&R%X\դ鴠e)ؿ5m[y!o/AO-='߂Ԃ- BM5|~sP%אv{C+2p ~S `ATҪ#S &KnQ2*אPlm>o`,AW`(.]kv>JZ%U5]AƳ¿6![K #|.>t$=ʿ(͒oA\X8pJ/tN9u;R>8Y] `4f&Riar0o»^Lш#o[=iulB%~O7| 1 Q)JIW9YJfzF[z%i퉡 [9].P; QTVʜp73Ywe gA}=5{ QQ$VPDW ?Y%gǮ#6Zzm( ttg4%uL#B~p26#%ϛgj{6gIn%yJGQX[Ƥ;C^\{+V9.YHӬ]E\Jði5n+9lU12)9,_j3VWW_.Ƶ l1Q."P2SCK"j&'GD/칂ۦoPGuwfi;c .Qo[J#e f\)o+z>( ΢첢\:{:r]/렛Ew"t'3A\{SeV;MX{Rc6rS-oI3N+pGM-J坽j'^X g(dh˦a-\lܝ0r4TH781I;;d{'Ǝ7 [y3O̜$J'|X}f^uk"m"m5E.@ȕv)B2PL%=7 ZsER5j(4(*ρbZj(f*1U?mn`乌! M>\8xo"40l;F-38, ѾóiEFSf*%$lX0W7t/BuiՂ{v2I//y.RYUgW@U-Gx]UQŘ z*hlZ8:l5擽hS5w(Wº jMq`rjn^?zz{p A eIǁ5@c7@EL[ 1w֙}~[0754놾pOuX7ejgb##巗MfK0ɾAsvCtܚF2$yCOܩ.pc}hj_1r%Ǔ@6v 6Y5-q!]EeJeYpնG{,1JjQ ꏜjL4^Or,kZE%>+{3\%SXoCSNHQOJ9_33hDŽEw 5toOw`\VY";!~ȥ?lg>rS$@L\-_rTE29TP5.o\J>Y{lm;v2٬h7%_H<.YyǴ"!C땨2<r@\BM8_viò2gd` *ߏy&GJAbu3B5d X+xNbaB#"ہDз V Uu!hRNys:7y+r|8픕VǠ!m xaN&vnpW=gp'xgdb]2}?K}NT_3)yL3ȋ>)SlE^(e%!RSm\Cц`Nb~ vJ;V]Ww2Nn@+Ғ m9L<|#VƱ((L9d| 9kNx&f9eX`?MGHJaArޗ 6Fe K"H`W!YLE?Sy==rGVƖPEi7PqrT;Fc3$Y!:=Ooef8qڞč}tVѤjG,V+2]WYz.fAe[+ʵ&._*[ʔk6M24\8vw5lT*Kh9;LdLjв ?_U6>">nz 07*/[|<}(v1bsԠ&*ءg,b%jYɪkNlࠔlN/π+9h(,?[ ܤ|_ # 97); .j5ZT2Cʴ< %ۇܤC4X uy nݴHqw )?<42(# Mf@ wF>HٞxCyw} oZ >vI޶P!Ί]pBSeǴrh:mGJ]mgqncßW pK-ƨ"|)T b$AnY_p\/ZFˆghn1+u?]GW|u韦>mSBjw]6luer\;}XW[=C;r *١l=Y1}5R Ӱ}PYܛ;.A$ƻAhG~~_W/Ź97՝jtLQb=3em0pΌ]YHulcH|wzyyKA+̵V< 3 Uy+iL}iOOqy/'w2wI3d}鍊_d\>JRĨ(ʳE2@{PBeR{DUͩobQ9gfIuCTsKNef2/JM%Mh֔}܏ٜkdKs3<+ kEր՘"[dm0cP⁁blMYD=&君RoQBZj1@ iFxhW9˰$B &-l3Iӻ5Sr72dS*WE rI-ӕ@gK i%=5)7R[:`Ҏ;< (sN!pX8`|rTd! " kͩ9_p[xF[`4ͮb^d ^{싹 ZḆ'~]Tndž?K#9pUwXvywyj*9Rrf?m6N6n7FpGoKl+~n維p$hqPz]sB[يA*dF;UM^W.]:C5#r5 ՜D°ĈjƢaK7BHj.`b,Si2Yq`fJSuvlUh~t^!pQٹ•oX&mlP?7WW;~f66./ţe!-` 1{v2cp$ґY.CyݺdaF܁(W9x}I\ϛh7LN+Boێt{]ױRdžSL)}s!T9{}غwP%jR^s1 Jg}0ŧԺnS,,Mtum{G N(İ6? )IR]eX[}OfŨHq"ж̛* ? ]ofj+J'Ya3*T*-`91bQHm;`l[^Gl8j9Vwvn|hA4Y/IcD/ }AQ,XqSJ0GJTlPIIGk98.3f8Hv GK)ck|R!X_pԑ F^!HGy%@'8w700ȗ0ZcN eY;׉zNʭa}]\-}-S;*6.NXX\`؟]dF5-+eU6݊$LƑjlX# i׋Sf3|׵FC{-ji,k[OiOݵS$ŕ+ dPSH~pX\U%L'i<lKD\$"ח{KMԞbRH`rDL W aAMv[=Sb0 U8.$W=4[Fp߯0l-])*mv/a&D5ta Vd&YGКr+pKRHCPQLuy"-'^6kvHuFYH|ROYhBb9g:ӝg-8c ({!8Vi=-Z ']o*圎Fzm{I ߇N0C*ybQf%Y5}WMVԯ"Eꊑ%]U]uqRХ֢H끦8 [5fX +Xm.'&m:1!˗N2d9\,e67Cub?scy1N<ԣ=1)J%q1(xT'~۪2fnS]K5;q\b\EbS Ofz2%V5USų7徉D7U"3HsOֈo+yn(btlTT15ԚsESi1ki9)Vvl{z073$n޵mm4?ИAnŨ$)'^OUp)F`M,z1U=Vv[3=Y>:f&i}?p "Ji :EVZz"@`i2g"%@Tm&IK˃ j ]^.GAm4oB9e- 'H{UAQ_>`}dշT ;h8a]mE`pE} `S3ß5]r[E0X+n&oP\CW1cÈ4Y2N]h)9:Uq7p6ё%|ɽ\D5oiБP|b2.}UICI>i2@Z6vSȧ'DXdh~q_/y\1gI9h©R3ԴSѪDP`lgW!ז{|&IdhBy0a|"9oɓuv> 2h B5 :~u+LzP_vgB7ۻ#a:#G.qΘ;m}:i>PK r,o0T9C`ј³LV-դ3|ϻul潖$3?+%*(8:LןW!{cjM{y DzK͹%~ ɛ&se|L7@e\T,\JMLR3&r^ 4,YYc2e}dE? Wfp9)-270b|M#LY>tj߀-AsR(_na^Z4 8&aj *|HR`#ܮp:c<Q"M2_%MkGl6H`b^+h'ďP6)Ae&phNdĘ\D`BVLvi$==_N4j|.,;~䁱.;X--'Q`0gz^n1]@Fw_i5c:B<Ց*ۖ8R}xgt=UtwnxOy̶''ܳEduσ<Dv\lڟTT5AVN8~'gj Vu~"uPd Q/ٗ=3CC4>A`E=CB)F'Oc§~R Z+s(b|f.L)Պ SZz%NiXZ.o~5YYPJ^QnCq˭I%3.-oxwCMCWOgnqbo/s{きL.e.~bR$_SpV۪?aZiE0,K7Rf8m0;#Nl0PYjVP~¬ŦBV2:Se50>uo`u*y -_LPd:2Lby=њ{Fw46PSUb3"MDz[LOkN^ uF8bb!t} :D C?h{B3>Nz69[V pp2%/HFbǧepʽv!x𶗬xAQ͚$H9û{DZ*D :ǯ@AtA`DӲ,{u7 >vJo})1]~.cIzkn=_+6a;4p*OWլ+xҷk,b$H׷ Mȣck8\y. ӿ} ԴWecn! I1Y3S^`خkL`)QI.{5Q-S`8f3#¾46:{r[߫}_X,EX$IKM69鑦3mDQ[%ŰrFAؑmvvh2V:AıpU\Fl:ssws~OhLc}6CNAʐCRB>k?شaVW׵nNC м!ZA13$3Z.(~n/p:`; l N4mx]܎pqy5;{m%zkg0LXZfwpX+t% 2mc][qم[elz|_yUǑJ6ܲ\]vKSlR,9㈆iUҲ^h ֳ+L颢2ּʇǀ͡2{psE-Qz讬ow:'TVN}C:Σ|घ['%p;9ʩٰÛ&,]o &$<0='`3{-*cIc'^8ܡLT"qy99٢_dEF< O;kkP ER($Ys2(ᆳԔFJ4;)õ=%rcs;D"LO5fQK/ T[3єlm"?[ ,&.:=w'VR_?8uJ.mD8X/<<?c "ͪY{6$ p""mkUSN37j2P(6Uj(`Ȧ)hRd]S#@yK-x Ux42EehR}P!*ѥrcud?ޅg` $6DWK |N}SVdU2r@%X>sP<;t߽Cl8ϟ{ B颅S턅%NiEoU1Ks9VEcr#ߦf:c/n a 1ڷJ5a6=}eH2Rp8V 8v]c񾍗{fUH-O&׃i1kho}M#;]D+RR5V,FhM2G4â^uXlW}x=jfܙub\0D|mgm'kD\SQ(0gg9[ӻ6COZdV4_n򔬣뫅gl (ĕK&5RmlKH/mq}LT  vmzdQz\*!#Lo{^gbބ*:6!)0]UOc) V`=Fs#H|XFZSW nq|K5_ͼgȦkRDUieLIo!1*MƐ؊agM@ĺ?3τ6syv閶ޅv+_+vMmc^G!^<p~5\ri:#}%X,_gd N!XUQg2EUuepWcɲ-.+4;`x;3^)0,MWc}JHdIektRu yCIdr˔z{6|gqe5nU­woܼs޶ e 'ȥ);6n#ÑА:$̙֩TBE Ɖh:"I`_TjL۶\+ֺKaS񶴏|*T.("oD؈gX .ku~91bI _#{{oO6@p߼Żsqn܃s/K$ߏ{½%)dҒn}Ț؊0|x:~X.s/ DiR~]GZ{x?]eO Wqɉ{TT|J!3)11-0 E;v\W6c[-"~U9?.JnǏvnnoov: [S~y 8ns&sV3H0P7sU(P4 jv/VGp#rvff{5sߟ[>e8*X`q+t؋EF7qi· W i0xN@%Uq ñ8G-5̒P Q MR*1b0Mp5żO%/R*[>Jy wz/ m6}_K-7RI!˻vB21K^||h˲[26M3ˠiv&'jngu56LS.Em3Gab@e_D,5y4vOI$ime?~lQ Cf8y-,<ԥDgu(Yb.ҥ1AB')_$C=)s'¸^nw9Wԃ|q$Es QW5u(t9KORm\|b\Rw D5O*+ir~g{Nld!gK'd^l NX"rPhs{^WdG4WZ#°jApu[4+X}˔<ec76 Mno6t: n5}K{f/Jmn߄HM*VkoT6z O5 J?Ҋz7r<|5}η ƊG bR'bU~.VTdALj\}>EM?6Ȧ4*&4r+2lNr7RCD:T"]"LSUEaYxGWNZk;k;Ӝ6{-w|>ڣv_$Nt D=?x8C 7rPwPh"њ.A_;eU\Ȕ;Y40:-Eir2,8R1 KMpa;J*<3fJZҴf:cIVPB`TEDI]29K$`;㺪)B1J7Ԝ,B[mneW\-sa7{Wɮ\V/a^w--GLPs5bJC19fC=O`=url_W ؑ.1EdCiv-MbÆ뿔=a}e]ɗyvTպC@ah {>b Ѱq>riĂz$j10^@%YQwZ`:%y6^]}1Ux5io13) {οN39##P.qwУη4:33¼+n"B1;۳ރջ;4攜 ]sfD&2v욃1yipFw^?PAf*M3֖<:M,J iu0ڧ TԤb8&DaK,l[񘚾ȓJbS3'$TW\ Fi?A'gAwX]+nm/^{$:/HY'=C cx8"ߝR7Y Uu@rQD]uXd(^sm#fXcFp>;%݀cdH 2J\ȥh.|>(kJiPݗS4=@0#F9dfT%Yl)x@ v[r)CkJ5{1oHx-Uw4nk7!HE=$ROz%3mP`&ak݇zYׇzH?4t[6ÈCTw<+zCSHw ժ xH%jj)XPLVŒd SdS=p#\>NrĒA9hY +kIpgG:`{v.y&|j5v+ i@&݃/?? FJfDsUwFME/lqd`I8$x?%P2q oUm;L1@*2׈m}gG(KES?:le!f @yO7 n1@i|*2`31V,FLL,EIq1in#?pyhEHsT[=-4=gڝUNV*[GwZH$nY&$*.8X'^g+YVNq:߅)Qd:X.R? `:3b9ʹp#SpvS1+)rh<yRr5I[.xVS+zu`ٺoFغ >ȭ8ۙ.,s-S~dg7onv:4и/qtwi\n}bl` Xb뇥gSۃ"^c8h}QeQ)h$O(=L}L|bَ щiE*,3 pdB$;GQ\o} qIFd[FHfԂJ-.s`r (ƜB SoXd \ Fg2e5NVw~H4lQ ŴgdC/$4f㺐jw7 ;WWK=s` {[~lW<݈!_R~Zf<|Ct#d_y Ͼ%F/;w}, 2>hLtyMP=ev?cO?UªI#~W}U~/ȞJ%SJUWi]4eT4oFlChLҒF>k729cQ֔.x0ZNy~ީJsu|ڦw9f{ښY!v*(rC~ *ɩkC\Fk^.%ANW+]'J"'xIie(cgҀhorN ճeRvEǷ*%Xӂ${b $51jl^Vׅ_gޑ^=z{{/-/lO~} _x i |z{J8q6xw0>J$N~8Č$ Ej6&o:VTIM}Hb|M>ځJLe29"{?&b&43sTY_֦U`hQdR/1IV0uyR͆9ɈA>e(hW|ՒW :ΣMNuw|X" K͟'>_WR_/*H*~%D}V. g ZƧmtE8tg8r ?))hJQ5m|CtG 2C/@k6 4Θ .o*&LѶ gwi~!,G-$sM ~I!T貧o})xPMәHlfM@ҿ _Ly&—^a]8!*Ԑij2Uv3ZM (5Y)0T*%t@5\G4pw^D'L&df)j7Nb]JɄ"EZlpCF٘ZWu@kV)e|"[-d׻#²+,ݔYTS z5 [,~ɓO>q09v͹B#؂Fc2RhQߠ]J<nKC($4E:BH&dW!F[\$$˨qB[gKuF? ?Vrsh.퉚k%-)1[6!6%5*5*Sky rD%$d(*V"̵yrVW륍YýQ@̥nTpPj-"4{B N%܃Ob>ovFT5=݋";)6Zzv6ӜT|~ΧPD `=n;co{r,0Ӓ-⺒o^7->1BNx2ZQ oNUd6!j,)l2*W4.5زI++L>-{ sa̋B_xon6^RBiu}v)_Vs}vc}8h/=!#|g&`ciԲ~݅"3̫qR8j\ʔ9xEw/*JqˢdM)nAg)q2O5PT2s,*Ctu[u)fG]f~R̭"Y_x_ϝF&,w~Xӯ-gK27o-!vn=}޼qCu Q ]y 脡3g:$Gap04q=qU66*,޿gz(UPDk#5+t9g_PO4r4eW"z}lj沅vj/:{_sܘ`0 ].rw劻w)R)!˒H,ʕr*V"ORrbKĊKH0v*?UII\RR_{=fPҠL{ߧ٢; ƧByϖ5` lP'Y@)"-W fc@٧ E_p9Ž +raHdTאg4h1 _B37eze!HZ[%Ɔ'dW | &Bb5aY%g&TU.3t=*:_, "[k58:F(4 M囀^ $ tbyvrrcuؗ Е|aIDtګ['`F D˥( =I krݐf;Dbx zD.±DrœG?ڛcvZ b-H5!ΊPK_X^+O]%};dD_!bV;G6&u8K[5"G{Y̧k)ɠ Iͽ?>lpÑvVR5e0K'qȇ:VHH@FTD^g^Alum{nAw[ͯe4gƾ,V挎/g&ԑugR$j3l!*Bq?<(uf@̣ଁ3N5uCdV` YR?NsV{%@9QM35mxB>5l٘ Sd*CÃ"VӚ+Yqs5y`4g_Wl][6S5bڪ'|9n}uv7;WJW66:8"6BɳnYc@'zPGǠ  ,SVPzzƛXڶlF>*?qfA,6ɻIR5ǦG}Qţ"qh&PHFhT$uQN09$Բd X@!Q}նcSʑuqV~5Eۢ'd"Ӭ=SXV M4VG/q~ߋ /FwcL,LDz>qcIcut-Pid. H3[dL^W8["nyVpfLMlI>IWPDq(̱\+02X6+:뾳|pōNsP[ F01BE3fyU^c&:XIXiPQG*u;1O cF?12c)b_ssB",/C6Dx04@}=]Gpc$G)5eN@rjQuOHs"dijK瓥d,fhG5>ڍ26'o޼YHԤHw L1"]v Z \ Kz) lQ@qYFؼjBn~$7{|1MV}E|6KgPՍ BGVrʏ#FAIiAhP9ҴP>KnPv|ؓ &EDEjb[QaO(F|*fƹ90_ty>-_,+R_K$t1ً[1Ma.xx4-O۩Y´!G]CD|?&}:f]+ A2Ї;77Nqq]~‚UH4[%R.>&:F)!q oΓIƲ?_Q$n’\8?i p j^+KSvft+&\ZI)#OS>?!jLOpyT@2˦fxc|ѱEOX$1gR]k'`K}AA@A.h ܕ/p0s%ˠW.Kd0Y^hT+Ν0Hu:=ڟ+_j 5` )TY=epi#b0SOj|C_<0C4R氕D*d+ni[e6" ,,[A0OeN~viu7H.bvHn5Pk.]GKT}Fܧ{-.%p!FrVNm ȏiJah 1:e6o8es6h2 zt  T+3tȔa-KF4HƒLW޷W60b/h MvjqvdkaAf EfoO3[a1)= zQiD=I]qH_4JYG5Ҵu7~΂4}گ1m4 Ԛ#Ml7I5TV(@X<^/z磲ug\vEsJ .%֨1qL|MA]ƊJ1G+b9 ,k;V3m$(DXăݫp(*s;LwZh/Q8(8,{ÉnJ푑>Sv5/C_J\@t2 %-BÑޤ)Ӄ戼{ $tpD*< Mj;۟ǶL`;Ÿ(bӒ#ZzwZYXHGA')r(mxX+̓?0N׀&l'C. t_c& O*tB"P)_4UdMSU^gU =G¢=bwrwYB?{֝n6D:N,-ɮʽ-0x:͡뱾FAR"*Fݭxв9SP5%?0 ,p zlPH+]UDA]$קM11Q,%t}@-Q&Tؔۊ ^%}!]2#]&jgDe3-UpӓE%2h؟WkG!H1*RR㜒sCV A?~@*GI>:P6<"+UT. C}|u"oWsn0s5ńX-oӊ\NqGue,Lx  nb< F8 z<Ov2<`uZ,#$B}B7}12T uWDԡM&S)n5$EDz-t*gRs~B{/1:yU #FjB*.K5dy w2j`d 0vRk}%.G<3a~tSz2>]:mBVmlvU=8g:DǮ>bK]Ht3*Ы)שɵuK޵A5 S M?A yB" Û H0b A=]u~]U0E:sOw;C}J.S{h HmjoHu 4mVdo ,})󣐔nDΫn s267uDZ|^7xY1(EUB69vqePd 2l' XxJ%8qhj[-jcE()%A͊"Hj EEe"gC6FTu ]+~; xp&q9MLriJT#Ia,ݱݑHt(YX:[0 rL/TĖ쌋m՞rW Xc,luR[jyҏxB<2&w?󜴟*w}s<*z8{ 0ёGw'":zvL=I_ X| >e_b)Ty,q DabTbL3&KRXOZByQ^>α)Y)T2t4*]B^rtyӤƮc?S;s=ɝۛ6I9]hC.!k+f]p4,U^U2csoWx#MYU  a&>8c"P@ *dUMg JQk@π:ƻĆldSiUI];ndNǪ%uL|&/ 7F˘SH-8{pgXPpq4{~?(F{0;Kd1 [A\:'\)l"U8I l14ϧ=]fKH/ u˗/=Q>_k"%A>/YVu5 ʦV.J"l]'S|)>HD%|(;RzlƂ~My[=otBPDCk k}##eoPf>45`OoGDBU#_9z0G1!n4'E`?L̴nmK歫,8R' m"mƓLg] )Ie)>&pt-Kq.BPJmEZ/<.#teUWُܳǹWY&{y݃gWf[b8Y?2ݝ>xZ}wGx?m w*)G$|>Iմ槱!6 !HʒJ(N $.j̛xUWx;-uِt?niBj\ i il`WU+ĖRz )A]  &YH5k1Eϋ"s`-#MR_Ytg(2=-;v`?'.Ϟ,V@f(r88vP;ɏBag|ԗtXl(f>=I1g7b4MǙD6zLk՘ ӬeS}qYzjuu H7yg~fgljϟwK;p&+H$pF`я*%^fxS2,|nRVw&nd*JIGǁcLTѴT4 5=h<~LJ (,B-UA-Aِ>NN{2%頄I"1x {/_T<8S]ú jڱBsujW['钺Wо{vwwu8ulVIy GcE+F~h[֪.э)#% gMf+1i#'Kz=o:;QϝG*ȖO0PPؼj Z|A5 ⧒#w겆飘QX 2"y7^,ӿGOa8t%w` @z6qU|{Ӽp߽[gd oܸ};QX.//.&\f&_Y6ڽ?Zr9Z[%J0]Ff zND'[h>]4Yc 5J*.9 HPWjCX:TѝlT 4hn}jdWM9-IAB gv%K2KjH~l&nR%q;QIJ"2 nTcIAcY/yA`BĶ8=q?Di ݳQLt˳dl]~2>DY(!T=z秨9DʻFtp^Y\cpE0;Pf-p R7X0uAA $U{я1,巹kCS;,Ƹ_~[ו-mllma#|y?Ĵj\Aq6oV䱒p>B#;T,_R,HfkTUAt`)K6EM=n3TRE1;B +0Ѝo RCW$a *X4lf5 [XWZm[EHw.e$6gg⪒LQa\1T Hi(cՌ "=􏹿Wr3&M^H_>5]Uͷ8y`ct'Բ3NLy,c}bdxŅ2KjLRrZ+[Ԡq}eBeۀ8M ^g/+^_=D%"?JiŅ@$(ʒ3+EMBے⩏`X1ŀeѱ;=%?&:uZsW#ǂ aYRn)#i lF;5PWP3C5Q[|yyVŶc Yj "r Lt7ƙff4ɴU]~cR6TQNq/wRÕǺhwwDHVc.QT+l/Ź:jYfօJxr6zq3-:8GF3X_A }յ_>`3 ȗz3ə8GLX30,.p< җZGJF ccN@C`$ߎXan@+%8$fak - - 7&9w[t7|h$H?j pSRV*rƖVdQ]=!I?Z}?<:2q "~嵧Vt#n_[I%5qIdk*}c*aWUe$=|S7E =@*=gtΎ=n=ݩstxz*h~gl&Xv76O'}{RD)71DQRXK'A05CZ/kЊW3▀֘FDDˁ[,CųY[֪=S=) ƚA8w*p3,\"O=O'0d襜 *ɑ:3t.G,}D[eBGg xWfFtX`PU,bH;ZBhfA'A=!ꎥa$VzucΪf i2k[ԟL_/T*O>{v:/ hB7uF]Cq$鼀6HM"@|OFKTʹ/615¦`T3 贀֫6XjQ}e+1}RsP<_,q\|"嬸u3@QOg`wj~i [l*!x~ѷ~ͷ@ot4e),'lk%EXMz(f&NՂ rcqyq}]ni9} `c:otLIʂ7H6@SŞRb82Y*pl&O)z>bH%t\Vc( >Ar= \Oh?|!ޢ @lrÏ<]x nk_^JΝۓ c{WV?B/Nv cHy`Y Uqv5w>T5B§QOnD&K@ Sj ;7W裻NOS}J:"bsyP@gJ.ŶU!$q7=K ۍѝoKv7xz.O}z?[qḊ_9<zcݬޞ^?r" w k : OUZ9(jaNTܗes}ǬUr6q@ [#qBN]b߷3fG鴍аSJ'xd{t'W^{,uUIνng(u yOvl3BZ a*U, Ns,:?y~ ƶ|-[h^qlHC l9 lʽ"]{v:2JKDf1`D3LMߐ"ήjg@<-onV֪s/vf&v>={">|7tڎ ^6NvZCӪd +{C\w0|@y[zͩj;†4iׄ+ ݑPA:D@ ڑt i~Dʇ |Rj|0$ ?6hD3?/ĥDYs7vUEzGj- WUZ_ǫԐQ@ꄄI/͹&A jS}'UNv襌)bWTdcgG7Z.Q=l41=cGV"j|o= Kԫ1ռKqJ+ŋ7oaܓȔ@?ds1:sfqه&ć^88e~6ch芰О^I0V=?D6B$ɹnw9SxŽ?s:IJ!@#8zƜz3y-FUȮJvpG/\!EߚIQ4-lrNҙ2{s3Wk׌s-VR(ڬX`+K#Hl| X>sfm LΟQ0H!ox|o9},ME><2e!emr鿃K*h .gr0$g̺ȃWT]Q=j PJ.o[ z2nyJ33+RJ+Ϭ?"trp:'엥&R%`\ndާ$KYӜnB8 NF G0_p\?1vYd32ެj?+ov`no7͖`i=R{dvR٘*5Q_{=ɽ?\\|3!a 7;әNd$>d;)R>0߆; mƙ%wy/ňyOL R"W)BMbǙHJ/%3# :9N`Qd<#˟ϖx "%|t9IG~Ys+iy!l| A(OJ,q*٣B몖,'*y[irvtf j"eݲ!)s +mJ5̚˭m--ŵvST+2ڶd;p4$YqciAtۧk41g@t 4Ϛ)PnyfbSP%GSF%J+8R;BC<6}kWB#\mA*r=%ȷ!v٦^<,l*B2b2 ?lօ/`NaTU?K lqUǰ-,0nrJMR`_,iXڟhim^=! VW&'řbz߇}7nlN?G7<:鈠9~~CeV04#c$[Y@)R]pgTs`(q]xF`VfaK D21ClLP{ex`yMTɶx+U0@|20]4 tЬ +59?j]Ӯjm|8_66J* }-uz+^yLZ {LaWϔkйV7RgB,fB%ess)Ef|T}8]ΚnmI,|}ߔw's\7t%t˶5U ?s?k4R۹>y1o8OrF^6sm\:9*;XL 7GIt_r]_o8_T9`?/o&e*ybT'f"bAP35|y"6ڴ3QJG)&fb "##. <R22e3iM}~$>S!3 VSh$WI~Zmhߞo~w/}z6Ͻåw}C '8;kSQ-b*2XU|p99^gbށ3Fw}c<)ƩbjYF'Clq[DЋ~cbg&0Jl`vl%ݙc""RxH<;fB g}ncp`bsi b˓S n=+? z땉6C~ƀ]{ P8H p} <"Ӗ6#3,B@Y\Ha$!< y Eq:4 -ȉ"X2i+ a 1&D%챿BZeʶ^׮^ΞΘvz{"FT+?SNFs2bCflt{Hjz{{HzEBSyަjF8r+ ƹr[;-5EJY}:b>O#Ľ}79 s. ti,ߌU)Fcn 4qrKsREIJsK/Uuba%AJM{Կ?QZQU2Zqۚ(cDF&f Ŕ\ eP\' et~bw#!t8{:2 fޖڡ^ZlD k8c C{e/8-nT!NJ|?%VZڒoh/KObvyy>b M`F#JۧaO~tF[~SV&YZz(4~h4y*y; 弒n01\&#$Ӆ:prLdJ \NޞSya[kRG>W4t4 %@!+/\PXK@-s?I?Mi/4 ۥFmAP;Sɝ8`I1魌eϨ#*yh4I*DNg>Ǽϫ^49#!|vH0 umidYx{* ߃:5T +)h5PVp$K%J.ۥ+hVK'8}>>Bc#9JjPKƬwi2s9=e/\y(r,&PŤAvs%/^Tc+tQ C.1Vfo:fFAw)MJTWS]Zοϟ<ۑ2Σ+ . jvFaҰyʉ3Q%ZUw]8I65YZX JUt`J$*2d% HTW&bz8@B>C&8vnÖȏȰa!h# S 5 lrEnv@.0'}nIw(ui2םS'WN$^`@y9PWhNcq޾uOcg.Fn8Kyn P)y R-liRҜAD5BAj5`-<[( B"σqu% J&/a+d⸙Go=9V.g''x7SE_qWQtq3 } 旿h}dx8D؏8r]۞>spҎذUA@P"V?GI'NJm'㩈IdNȻ&Kw&)c"G xTsʧtO/ e`[&Óa$S9,w%i=c%nHr";]fTg"Kb3\O[MLˠij#ΝikWnM=;q|2hߚ}Szˏ M~DO;葦=B̾{Md{v =9'5>-}7`fI̜(~(*ïy| ][VjR޼zK>jG 922.TG=F}jD>MLMŔ C5,2>&CLEs.fmE $fjζGQl)Tr1Vl23_ JՐVrڽX[OҞ۞9[mksM{=iUFrX,}/6|PwLdvmHr&6h`G׉J'}fϡ3,UPE5V@Sˀ<%՚)żB=y 繐K<(񗊵;,=%APPS3 33 )0R5vK3O?,}w,,.μnNdpyP;TAe4mQ]a落cH jVs3jvzK0=(Ŧ A_D1β|K\Rf l&#(?[\\Ɋ&AJef X0$%Tsi̻LPޗ״V\P|Y9xpQV³ /ЛR^(jbzS+I&S#P/:|8F~[y,/t:ذ$ }?T]wb~x)XD ?˅!cT}ލ.sImW{Y367 nVᕯgqu"q88'OчC`- zn1nߢ4T]2vJ-Ay@ pĽEʁIi";I  eX"bn@iqwZ7@oj2ǁUaEtXApma㆝\i)@^" /#fΧ)=w1-@wq3-~Bai3v{e:SՎP^7ꓺb:ltD{̝+ ER^cJ1hר0Q֋rL` M߇J8KZM3yʻ/_R1_PnJ P';MG'N#:o} `T;T 2i\} HA M]_6ԱG/>b7v/iʥv} L{=L69_p+K.KaºcG#Z'J݄_hB#@gQy Ǚ)% Кj닳0%&.|ssY` eԚ6H9Sln9Sf%p\DiTֆں5ӗvZmWFOnwDž2 -?SmfBm(_"9];ӆe!.@\["w@g9wgAhW5䦨l ϖ۪@bY'ҙKvqC, < Ѐ7MI߫K>}Zty+:5bֹsޣGLJB\EWO^\de4ARl qe OύLJ 7ohG[bHkt,݁f&;m%wru@يPwB`vn-z9 ц-.c$p-DX2LPO]K|I&$6ug0IrLyd@Q9ф9s>5{J¨WeP}g?UԞhOoםgs9;wk+7V3;k;;M(i a>:cxl|y,F{._敄0F";RwPj8qi KM !I;M78,H|}+9Gul3V6_KpA``*QvuAE!pUzIw)W? ƃ{4Ns~ Sa.w/0' Ici~Wx`*dGV':Ljx6q|2=#x2@]R*t?8d|E}噪, fp۾RyrGdl'Y]%wL?9y^k*gZ6,9*U8XݤаH  LZ@Zem%OQ١ӻWD i"\aŁ`LM3c{jU;C]KJA $u4,FO9MNsrAV|W"Tt@_^˙aKoRZ]]=ݮ~GhXZߘ?3if4*]cш>5JQx=owi&j1+\q$= Vѵ  `͐.ncr<((d*R Cgt~!H8zy 3$mm^l7X^6ɱi@5eLQvYy(Vɋc_B[_}j,#yݯ}j%itV"C"dZ,udm1wjdYDUϊDQQcSd5#@I5a8'䥲 ,g]-AyHS\~s;.pxvʈ\6m 9597 bNL^lZ_37pWdȣtH9P`&*3SwsAͺa|lIōҜ0 1bĞ UuǴsôSKSOQbICAr# }i$u^FDfdDF}UuwWsLLܻg܋܃4)[Mm!K"%Lа%ʢ% !,ZeJş눬Ꞟ \ٝ>&w}ŔmmZ0f~.V֔gw >ʫ7OWcs{^{nG^Xyr$ՃH"^l.Qoǣ`q1M7@ca؟_0bIym y׉ išaCiY>7b_.X -Rc.ulJbѶ=PAUTo9{W7 O1,vl\<5W=+L4q5㎜SoO&f\*pQHa9{s?+[[ٳq}6:R\(Y0bZ) sj x{ƪ-v8@9\PȠXK9h 8-; 6k%L G%]T ƪK@k \iCj.鲕aOJX=aB6duTWN W#iJt= gy$ر# n] $jP:+దB߃\oQ&?~R]dO q/xJo?]"BRǐܬ9r-ucI9\r6ϭ ΁bߏA|`ߠ\3XAr" ̓L4=QMŀb=3?[uF,B^Q$k%h;ɤa2h&jzƑweSL%[3ԔնfPQ ~CeH e w)וG'fR{oh<0nCc9:,w1.˅psxSRC#\:@ ,Sols%MO2RK`i[a!>1=QOС˼vl[g0qL52 Վ3LmpWuDh84 Z(G+9ef36J7:T@%SɐS+$, Շ;ߒv~ 꾐zRy u?(Qt/M%h2F% wsyw\@.uqM#;<>wq~& 9D_'rdtqpkj&O )T&;Kw$ыDuk8#Ty@q@9#5lf>ש׀4O"ܙf\VhT17|B b l0n9s C6jzE|VI6,=*⧴IgtǚJ& YthhPz1&LKcD.Kf- fGIBDmfsv=3Zӏ&#BKK6fI}ww]xzw0kg?FODoj< ; rС־t,6T+Av\wtyu$JW!uSXjs3iC 0ݬ|.YО3UMbf tt8eKU2]0ezLv5Qb45C$?qZJ>D97ٛN3;۔͋G8&7ғ<8Is@K4?s߄A|9s 5˖ WD3g:/hĜY>Vl\i4--}ݑ;x6sgsryb@2):Q4Ca46rO^\n8 0N 3=Xl.翭d$i800 ؼ\20C\plgY dɮE))C>wCNrfvf<=B6\Ι j%[oSSi^'6 D40en{-ΙPZ Y[S95KN!5qŶE-VOt>oxQ$|kEWqH=PfY~8O%.hz'|C/bMWs?ظl8qif V5Lɵ"gLhy/ طe Xiٍ=_v7) fe3c+NNAx#wH~`fT߾l {ʚ(0ʦs2ektSu9u !.K5%wqaےfsݛ*iW MSY5u3HF )@R<'Y('OIdžM\<OHcP'V= RŸ ajrkJ{pEu@$I/n.f<4Rc 21Լh:egd?$N6rƝbLڦB4+rt'9Nky<=Z5Ei Ҫ Z9&7wqţ4\Rǥ1:"G)-ѶL(W)JWim3sw@Bś,W7Ҫ妥n}~#'e m} 򚡙Zta:w dۭZn[^Mp_ d%lL?}4/X9܃[ $"aXC%rC""^1Lo8gf$_B6r*謔8$*bW[鵄8$3I$kۘ;7, -T1"2퇒V$3!*Xi,{Y r$Js娡<cK;ʨQ ӎݰGExoxZw!#mHVZ(XMktY2fĚ夓3kJF%K9a䩶 05֯rgf]ƕ$x'0$wp2{ԩl|U{faz$ m~v8Nj) T, l)B4=5G pwAua ^R-V*KEa3t"}x!r0R -[z2F)Dm eۢXdNu޹ewt}erНl h v_dRIېڌZjXYkx1<=۟KC& 4I-[p)eWgHS+Hdcu0$ZU2s5q-.\o$Ф;6{u~Ӑ^Z5Un"l#1=MH,0g? ʲr]2@dki=txtsiEٚ:&?w,LU_ܯ( Q\` [>? uS&"̤_!rGAO|^R'P}R=ҤiXB_ZZP-K'\Qr~FgX᳈/$\ЈmP&~#ܚYeOַwsFLLA(Ɔ1e֙3}ӫsUn~ZǞ1պ-fMY+bWDOWd8e-\ ]j;)]u]e"yhM` jPp-sHM%B]4p58x.ru(K"%V֍W#>^fnXJ~yF4s!qnl@t3(-޹H8K66J6Rq +O0fS-J54LϘvJܓCcf+=z 9"@NgjNqo+/^dX5!S(6*i|bBq5#ep|z2 Ӧb-X; 6~ܚ&h6S^PLnMDVŅhX= |l =Ǎ ;I. n !=67ߛMEzw/2/W̊9H6Ic"YGeSXyA,yrH^qп3ܷ̿ Rf C}'[*5j4YEٹ[Z9X)v#ÌHo!:C}-Es|OrvmQ`/$px;aO$@Ru{)I,mnyacbg)Ei L!IQ`Uh%zw}N{Z{jhR֖{SmCOSыg359ĝ BȠ,s]\- 3k@6 ^ISh'=>lܚj QU/&)Y(I1w:yנVQKRȋ>Q5#߂7"޿lm׮^]\N nnMZ Whzi`w084Z]kcBSK' S}@@RcdQљZ\M5%dY3Hǰ!sGkU~EŐ9Oqb9T_@%֌ &ә4Hۧ~tkՖ\_ka}2wqڶݹ^wv5[<)Lю7LBc |J &AZ$gz+6Lo3GxҖu<9XBRrcB ŝΧ,, {"2wT*D^;h&*C)2Vq3L? 9)=PIQ"BeTFAe2; '[Ny^6)\L-7okyz9j&\qԲ󴮧FmUE,)erB2[PQZ>QJ d_x.UCy%_@pE@2Bpz%-ȘƟJIHrw `θ/.O;.Yx_W5DP@}EjG&Ͱ+ya|dR<5_mtӌߏUێݕx8_ # uz>}释dOFA[ⰧN~ lۯ^Cє2Kj,T.2f:Xry;vAc {q4C%})t'zQ@[vIs6sn0wfsr%CN`VB-L`(pj~t2&rh{&8OW>K桞Łn;|e> Q7G}ttR^m:URJ +wGGք)0tԇq ~R$N6> 8 .InŵRIz ":d H9 5|W:])F 4b3BPuK)K:B1T+c)Ts+:bU͚B7 3wnJᾕ΄U͠zj?URI9%f/g`S@0<bχe]=:靏V.1fB}akC<v,h{nMO3\"Xt ˳vmKGʹwe[3~nF87lB ]w'0NF$^DX #TlENiѳb^/'H%>TПq Aɹ:XĖĄʷDm ]RaFVy l\V[["d 6Y1քWDe(/QFiͧ百exۗ>_P>{ݐ7lqP^K(?VveX\`x-^Ooc=gw@gf\˟WUAjINݻߠdOePvS\Γ[G Ƶydsmi؊L)/+NYdA@%Hk+ߨ~S-BXZ9zQ$>obۃd}J%]d[mO Lm6cYe,10^BvyBp'ig:m I@IgHL&q^kWo]uowq;gx{nXzacٺe;z8e\w#S`ʃ&gR JAgxܳ_|{a F|qA]{}b~a>W(_sÃ| <>_ 492=G80#Ɵ_ 09g3?`X!Yw$>y|{񱺉xM0Yl}>#0wtz;;^s['8w!^c2@8 G==b|k1p)|a>.\_zEb;"^yǟ/67=Wig^cx /~jE^y< ڟ=9pݫ|@x陋;\lWO\eayoUÇW7G 7.M?ꋏ1>{|9~."~hx^]2g~͗p; 9Ə[?c1qۇNewL;gbwWoy7\wxhq7 M{.z|/ Ec_ѣtƖĉ_z+[%n=~SL_l8/N5GpS D#?~.O Oq2^}bp;G 6{?~`%?q*m ;dGs 𧇂Ƿ>Wxq;\$|we=92xBz!nR\n#|-<#ڱ{BGb{y(acn&x#+6wcgyDc:mcpߛ}<.H>x@P҆#mۙ"¹ o5 H_r}|c]<'{;\e^>m7b4QNs@<F1C+>}i^Lx<ƸǢs{zm1uvgGͷwG|agFpx\Gز-<AZgf'@T.Y:~X?fiL=}F]GWxI^ϸ^ +*r&4BR./\6">ZwuEg |ǹtz.`fa[Ηu;G:|m~>yp^C2XN=iu} 0Xѭ#tt|w%N|k o2k3rgyʬ2%M̿~/%mY:es <υQ_OoW?6\/77ߠuosoyի|7p|?7'B_z{ 86__svk-3fV_楾k|{.t32z/r}V^yvSm?^ڷd[3^e}q\ԡsjzA׽agZg92Gg1Wѯv?>~~%, CO稼Xȅs|}Ƿ_ۛセ{. #Z'1O>˞\g^w=bj~J߆!y}FWgPvYcmUO^z置|߶F_z= qs߶s}쩽s~\x2 =qЗx6%;=u7y^n|o^x!J9cjk==yl׉g%sqsq5r~~Ɨv{r'<9sQۆ8}oo-~ 0콟f&eSU\{n;k}8 3f\҈ݱ-ɚe}hQ-?ܷ|5D5EG#~*ܽ=_)|i\m Vd2+c-6>:֡[V|kh,S"- ,W'\ۋkښG$h݌}{9WiK!g1_*Gh=/Un- µ?\|JꭙrTɀYk=)zXHT%A¾ʕnuҊ`ɳ崇'H<͒hBzE#i S9Rt\-UBLYs|:"B줈Z%j JPkJ2݆>)(p,_V2Ne]Oϰל{+&;no1p9fܳhYX Q=J^>sW̬n4g(i*jY@ K{'d;qyC{oF%Gtec)_C^Җ1ń'4x,k@ _'r:gV֩uG*REZlf@6KpZ9V}9Ф65Œg"~3xDrP׉$TRH trX{#nc`ߵ\g@-(xPi+BLrWtҐ+Қ*qAJ.Rh®ltJfk{/~ܖnGSqf[̇L/#W-"Oo/K0Ze?CN.J,DuxU3T*V1jİT0̇7V0kb: nQ6pˆHN۱eb>^ލ6q< Ӱf9;uqW4QB3#caϚ͘X/(AUN-",,Y؟`VY:"1> [SAGr"1_z(US1-gҵQ0i.o&6T^B&@Ή?y<ɼvG*IirP6/*LjmLL꧶"Noa, D{>)tfuR"M،ׅ;g`*s m]oFZqai͏"Yufv=Y0;A6~El%PsW <6A Cy / > (*hi/1f9GSk-h;MǙM̂`<^X" ch,1gӘ"[ǃ_571^"hz5.֕eel7'U-tņ_dkXbH"H\CZVwRE$\B!kdlx܉qKLFp;R)c͓Ѱ/IcnkҬ = rLVlZ"f ۺCqW%5҃OV:⩸0heq"U?*=ktfcݡUwI>ԙ e6#,Ve* 1 $}"t웵ri_>o\:)=سf)&v4MsQ> VQER8ue3lGӾoiQ+qdw , IwjI9&봹4ҹ7Hi3ʣā'ΖM%JK lZy9]`\lh?#'eLϜTNa$0^PW:N-,26K4c#/͗7BzbfXnmY˞f#B5嶿iF(IEj^3ot{W20gE/jfl7ObO0\42;pătZvW9t5Bf2k{ȖfQxpX3Z#bHlh)Mү9W)mz9+s:TϥP݇x>:sCѣ$YS*'N,<]9/Zl<#Cثj Y<B$ b>ߨDY=!m ?4! u%ѷ"hzYѼ afwb!Tj-'l_qr~+#ZV#(3Srp(b_r"羛(-6Rz#JobKe@hXH~V,7Ty-oEK1$ҷ՞#&1&޾O}]nG9PY2DMmk*fӵ-n V  6?VK7S.*Ō8J)N虁S0J,Y^G#-5yLpD ʵmJ#ڱdi {rq9il! jlV @n#jC,Ήx`|b;^0GP, SGE-\_ŮtnZ%>5V[7^gqDDv"^%}Z> JZɐ];1Qz9^=8VfzFt{]Z*ZD~HZvcNJhA;J̜~HT'h?v 2e+?ayEerM#O`~ #g#D+"!-/Ol V8ToƍirJ[`Ո*=6#1ClHQ_@š5.D^_ːTX-(vXF3iҡ+/ЧQ1[\GjQU2o.ݛ%a:Pca3YK0օC]-xZY%Юu"[}Ww) ?njI-Q1`OR..mB&h}d񦑡TNgc 0!gG !ϸ$UPތ]NG|ʈ[2jYCSǵliVooԯ+˓PƎC& [ E hQ\[V's!l{aV<ۘW{C 'ŒPm]kY"!f*HJ>>iْY.уwYnhu^8'.uij!HI)d,#輌K(uFgv7w77b Ѧљy7RmB#G.qؑrlškhHT#)9ck0r})o k-8''c sVup$ByI8V v E;2žvDcw6&f[ZaOR6b1uͰvN Սw3'i,>̏ e{ SD# Vfz5?ڥbqAnXR"jshˁjeʙsѳzB (dXLE|xMs#8&-!2W*/W,Kl].=2'4$?䝉XA+!hӂ8K0yW 0uvJ'LC2bChԄUYM% I)Q,Ҵ![iDX+d fgw* $%QYٻ*S=9˥:I8o@Ov$]CE}Yc \AU>:d vBΗ-62]:yaeL6`"L4dp4Ti1-l6 jGMKfPb"] e*_NVbgi,ca4=Jn*PKBu`v"%Ie;W r_<"MJ՚S GfM+Ȣm"Qx8# []V(W;A%5B1 r)'9B*m "kF/ 2c鵜rd,xNѱjY![lΖV1һT[aDB}VYb:Zڕxԣ訢N+TYZ1ט֛P=+_$KDހ{,6 k7ahtGQEp ]at=51DK<>#ˇm[I܈q 'tQ*2[{]2n2y|2yl*Lg6KLڗOј QATQ':z(փ| 0.*,][N)" oj֘]vqSu-.Ѣ6+dOX-*gwNTc+[@I]QCOc6/hf3v=[koFE鎌3ӖcmVQIZdOkSH)[LZb |ʕ)c؛R<Ӳұɓ`O6Y \\NObiR\eu6lk- w{ FZYݥފN[O]RŃJ2KiDЦ5(F,ʓҋ؞tDZKf%[0:l[7V)mA8zb[4VZ=e^>yS]WФkRI0 =gz,pA]퇵3f}Rۢy(v8ζc6^̂L ϸ6SԛuU0S;2nA#N({BĖ e2D,DMĢiKәxK\=a"~L;<>cztׇ(x oD4CZ|_!vdL]o] {VImPȬiĆ&zZGHk5#xRNXɀsAְKOOf(dFJC7i\EN& 50aoi %X p"%-Mؒ$[*]S}ߵ;zr"=oH% [ Q4ڤ#j+"•Afm;fkRiy lsRDGJW&;$ +gd 5GR.pnGg_ yf&WDrxj5$QAd6?O5٨ٻ] Nޠ}&jGGNs3?U_!Vu[1tHvd?j9VJ%n^5!X>Ddq=Wv)!9y:)7O2&DV$=xc:5%! E:g+@d"~a JC";ZEVB[ Q m'lW{9:VGKVBdk$/9J& &,8V<ӵBY:NY9-9hd|P\w#g^RwtǫFO4ˇ,Fx:%}&錕^8+4̨z2]WZMq9q32%u-+5J,GASQFw#=|1>-b]Dހs+iRȎznJv|#ߪ+܌,DFxvWLْl`46,}~o j X.fS-De@R0o""+VaY-ae\9l<[{j@YDSn6~7 2GyVng㄰c`mr1eM>{FQ^;d}iV|Me%ۤՍ.έ3rzt׏]z EbD>/e8&~.(k'(&?Ɉ,lus+P=hL 734skTr"u6uS}\hsFe^ri բ64z<yH GW/XW6Yĕ>SbToc+X vg5j8&nv'mƮ·ۈ+f-sIj>"2F<_~Y7}:D%8ɢ8;KQoXل^1vjwb.գςc^ }-.bQ7gߩM:tkr\ Rxl'_%?WOu PΔfMaY+hޖ[X&gVG+Oxk)S2A՝{Gs,01͗:7uj8qU\ `:rA$)Pf܊'rϔ.KZZpN8l8t+7QlͳӘnkmsVUl >QeZv{AB{cYo<{#9!EXY.)lw<҈fPgB\H]=a5ye찱7ǻׂ75܅m{ir>h{a^݆NlF(tT&/ do*Yee"^KXE'^^Cgpyq^ÐQ*u]X h&̗M?Hfτ])k%v N} 2kjM9]"ysD-!gU=:%5[n7jY*,jĴz1!6| sMpMɅ !.P4Y؛:Ye[AMa>P6yey8riVG#ȃ]hJTtιИA֖[ܟ1r|Mj2JP$"<9ME, {k*Ber4BY}(QX0CRvW{27c^ v92yԬ|yͺ. 5]QA]y2;zI8Qi nNuP3Š-% }Di k;1ذ^2Z;Ӥ}9yc2a[GE1W$F1w12iֈ'1ke8Ee/{)%55gm|[;K Ant<:>o,XQkRezvoDCW8\yE>vٓǖT.geq7g4d.i(FJ^Ϲ8gwE'βڬ&p8yUvbRNF驋I#HSDXRl`!ǀ tcV߂mfEydt.msdGkDl.$#_p-\{?q?L4jD:{}x^A{i<ю>ڑ҈3lXqwmy*2=׆صGI'ǥ K. ~Pq^!Dw' _hW_=#Z 3*/,xyg3 &<2@ŸmRƖ"yjp;sD1˰œPp?ek#v!0bz>pRv {3j tvmq$1onXr}kN ftO}pe]+q|k*&нp`A $;ʆ1eԴĞj[P: TKo.;[ƿ5TGgئpk]ЪW8&~*JoYIlG׎T42kk\CW1z4Se$*8}v|iS)-e*wIMXV2 5V2,vȐ=xs()6&yz2_Yw)3L({s2_PN&OVNd3ߧzxۼ>Xi@ǜ{IZڶy }s5 ag_I:ڼZͬ0aSqezۈoyze*zSz^ORߝ;8vcO}42Ƹf!:.CJ!L>nߨf#xk]{}'9oɯ[U8\%.Nc=W;=TJSnK\pY/ֲJO\Oteu؆mȼLUqb,1Wo:Tk%¾oBuu%K~3֪lZsY8HUȯZ2swNJՌT_"f+S1IqT&]4#vi>MoC3Az-!?=~vXcm9ifLEa4pޱmtXYFt1.d~1 1 DIxD)tg@}6s?ֈ~+_8Z~#/yw_5AXibMsm˻Yz;kL^9z&ݭ32;y|C{JlcO\%_>hUh 6p]Be!CBp|A9T>f\5Z)Ѕe`ݵ$\,K^~{8D|X~+\eI7cM.2/t|zfs{TڒlfQAexD,b$Kszv_7ipBڰ똋Pd1b$*8C2 R K|I]ןXHb9`(WeoP4"4t*/u= /8OmmUp[ϘbW7h)"vI6V;A~9(;GV:#=y 8S/mgΥ{#M,S.vxBZ1lvFt۹KT <^rwkoD40ob㣥Y4~G=YegldNǔ+7V#OHyhFly҈缏(,Xg쀎-j<\E4g(64GǞ'LACy ŎrΝϯ;󲎥Ѝ[jŊLS゚>8tT쥮!8YPu7M9{\L9n{Ll9g 3W<oSo'xghjSyn-?)^.:_>Njv/VEpu*:Dz ydmNs}Fi>v!z[x!}(9u\{eٷA e]7g^2k~iSjg5/V's7[[>+#C|p'_5{ᯇ_~yW 6<<|x7[u}u5|u֫kkccY}au՗W_^}ٮY=cߴzv\\ŕV\-+u^YYi\Uewww۫{{mŃŃvWp񰽦xx.(/>`*>eZ|{37_,ho*.{_7[;.\pp˅[/\p}υ.s\=?e[?VǾ'ϬH#}H緍}x=GjsG*>=Rb/•f#FZA endstream endobj 319 0 obj [ 0[ 1000] 3[ 500] ] endobj 320 0 obj [ 500] endobj 321 0 obj [ 226 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 507 507 507 0 0 0 507 507] endobj 322 0 obj <> stream x @[eϽ7  !a;JKҍB4 ZZ[Ekqk}Q;UmHkjںu긏uK+3y/'9a:@4^dV4rZ] ȵvTV7wew\ hj*Vy4K/U.:x @]7sFqcޖꚼ8lf4_׶;+LP+}p;wqqʻD#k+8\o:Ջ/ip&W_;~?󋗠A-NYlŪ+-7_pu)oc̒/lT xe:]ǼyE+_9~'ePݤ`?ݹ{Eq|&VkQw'kEAAǝӝ!VLv||[xա"Mj&U$XOl<81d,Lz<2tJr Ȧ;A*5l2(< ިLe!# RNfլiM"sAy d\qQ;;+Lq$ۭQfQըUJ\&d8jD/s9Yю16#6xdI\|TILb9gg5ѿ!p>"iҽ%%HJbuI)Kjڪ~QH-jΟ&r VSσJϺ ΚF_M-)EAԖ_QWJmK٘|?kW&XЖptv'm3jw8E,Gu?Ӂ5˝&wpO, [6Q7a=p8$6<FEX` ''Ϸ]#9/Hbi ] fg'`\m .al_種&5jZӟpK}G?QI ,mIUBQU~h[ϩfkڪi-Go;-P-l* ױoou\,lI~O [¢0cwIRR-QG +*ۄ-4xqTc %%YD+EgbK;LΪz%U$3$[hLr_5-FDШ4PXzhT`'|kX8G'\،dbQ~)-\C>67k) MV*i>"E%Cf$*\J:)=?*{Hاr44AV&_Q[O7GmC4}}O_gMے2ֆcrGWn:˷ֶu \Csev=~wnSo @<9?|Ed噕YBd ,L^)W&$jl6< ɺ]msZ˒ C?sL? _XT:*+Ȯ`v%. .C3́.(8ZkR}I{m-I栶L<)Xi 8cu [pَ4E&؂:刕bl0R^L{[-Si9P(ðSr(/‘/M 5 |da;k!')u8Z&e :Y(s-Tc e5~vu-)w*[ZhRjCmkqD1 U@`d6ـCeEf4,*A%Lqc݄G &"Hx; ;%l%l!|9_p7.&<۩m[ $BpUa#F #\Kկ!p5*•T .!\L_@8G8p.U@XO8p6,™[! B/atZiS k + z+݄.ɄN@\$2‰#,&,"t my9لVBK vG8p Kh&4f 3 3 S )ɄzBPC&T* Ba"a0PF( XK%qbBP@'r%\T݄lB!AH'R .33Bpb؂NĔ!(DB!`#b VB !`H2FH0AKԦ$ ''p Ä!ÄC徖f$W/ _>' |F0H1o>D; D!5]x?]x+]x@t @t-U+/Rc/PcB=G%/CjAX8'5q6E%Ϥ"gx6#ku폠> !1j?u3=wޅ N;PoG V?ނz3M@݈z# %kQAըW^z娗^zzbԋP/Du?ǀ?\vn] mli tliuN&tN",#H8p<0>`b(#Jń"B!0uG%DH0 #h "(zjg6SAOP?FGηPD}uP_E}2K>uc(~:lɯ&"$B!T*Ba"aMB"D2lx<(厇ݨ4S MY4FL t4TBa a2PG% Ʉ$H xG%Xi1hu!QB-7_D K~>{WԷ1{Q>$F㨏F}u>6{QnAE"%FX0pe1aNh#'#%!&Z>±c^B3!&Wg B:!Jp ''p#s2:!:EP>PE}itvslm?sϬ׻~Mkڵ6kmSnZZiknZ㕭ZkVׯڴҫ]N6Uѳ犞}hPҳgw0)_sI%B7C7_'ܨ<:Wzgh03uPq ckI-ȁ.̆epV_5s;lbWOc_q}wQK?W5[\x!$T6|aƄʖ/x ,Ғ9{Efw&^PueEHYrVta%zB={ @sdfyRk*?;pep!U=v!ŀ: ×{3{0< ×xށpp\/Yevb 嘊~#Gۆ/~ZT?`_b7{ Ûo{ zc)S J9'_W-0cіo-|0ИQ9C01 2N)LSqjN8=g<*G;cQ'Ԓ%\gs3K\<&/v4G9CyRѺv,3l:˭k&r>+䊸q\)Z12˕X 3a{(Vq[q|֔g.sxxU-CYzX<$GR[,٩ţNh q,!#;Z+$:ȗ@ fDiE47olhd" "D[jmNWn~^VR!fx\96۵9^gޝe2ڠlt*gF,Srin4aJ<$|s-V4[LB fx3}j|ySn?>t+vĄ;G`)"ޖ8T8.^]WP,&kLc.2k- W>~xwVК4CyߔoLztCx I~qo Ψkr4^\hiɣdNq-d4E\'lrv2\l1 + Q;d*Fa΋IsOibF1$^(Zr/44JҜR5OcxN[?ejΒ+_ߌRآJ6c2ۗŪOο[B16ȘE),_cG)˫%y*Sh-~$nKj1$Siٹy'wLJ,JBW\F-q\-9ű{SڒiN=9hI촰 I;;4tiEޗqorRћzk\YLwEk9ѩCBKB3>=Rx)U"z QzR?<#$hL.I(uΏgq/N&$mZSn)L>XFGg>ztjbŤu:(3 AK,Huz{+ Q-Vԫ}H.}3_4D=U+`:7qKI<1r4@"gJdH=(>#GZёwfQ)_e*SYRgH8NidZ)űs?7K)^,| {,27KLqO~- |3šk{]^0}%%3qg?wiC{^% u}{/o:=JWnkvɛ,KǖN!;8,ɶYR$9C6ڦS҅7@(%Aҙxm3[kLa{e$i{<=W?[vP~ U@ؕxT2UF ȅ*6_ɦchZ56"cZ9#aC7gUXzmrA=Ll1c ^3.ToĄf* xI%%BJ,-W/Ϛ RfRe+ 51P;߻=|[X4;#vBzH,\Gq ;o7ꮙW~z c[p7dyUvEzL-g䔘rsINm_A&֤b% ٥o(LvF1ЩDe\]:ƾ*Iu[H~Di8?W ->:54p>4|f{dH޽\!䲢-9tɡš_鋛Jkח ԶJ:w8~Ʌ 2N2 lQP* ^{si-|fs⿥>>R׸5nxZ;&1֕['Q'=֨ n%97WT`GΠL)FӍY@{D; qfke'_sM]'_ҷߘwwYg^_82?O¹SYT)s u]J+8>GEž3(hm+M}75s (D(N@KNPR пVi͎]*FYU>1<n>9{w\ϫ(.t/nH))luXK 9bk쥶G:~q ?9=F~ugl7(f/Uf]*UCzѯl}H*Y }[=kj*)N_(Z+B0@9ܯXsZ6hFKI[m'/xC[KRG{ ΦhL>쇣 DTǯPӉ6XjN|`c7|p N cu`rm/kϒҧ~;>~Aꁏ>Z;8* 33>S22PnG9hD,3OA=N5G(FO) RH%4'OG\j|C 3 9x4 @Y+Ŏ_Sy;{ R-mU*S[?R1^}'ߦN3? ?N>BpfQ#NtyFTx"R-zk7z#WX.?N/*Jׄ?隚~j-'p߾ 1Գ%u.d]AI]=wg>;НfSN˞!wc-&(򠢠(HEq1w?ϒy:-7CXU -QȿΨ yP*[d:ߚe4%о@4'Xuau!w /?{<5|QUWĿ2*wŗ>.xR΂D!ICU=Bk|sU2,at6KaEwsqSMUi0dم9yVyU;.!oK@'u5Ta(\h+L}ŶxL3;@ȁ =Ven ֺ@n-v溺*s}Ga.)jsssˬF{s*xOT!km]=y9jʠ+9tǀwdJ#m^yo?[d=VQPQciҳHR 1f\>/SHhJ^e*Ȗ1z>oZY(Y_+Zv֭ś#[=E]Tݪgުƛ'կS`O?V!2"^s |wYKRme렣cb}Jnb}af4#9EYyvA+5s:c*fCeA[g_J.åug3*L&EYq1RM?P˙s,~R{٦;'x/'4{FU?>e O5*1Tf*̫j-ڷ4X_(4;J#k4d+^^T><74x)YlH%|!wP۩Q:zmm(ao+0ò~t ilUV3N^WbKo54KRCoP2_Ɂ,ҷ2ŲnR&^#F~MFw?R v?GD18 B;;CHȌrFԁ6rڃQͣcUOdd&<nZ8v>|8詯$wYr7:tt}mVV]ҮtjFvomw:۷=(OMّ ۀ|u׾Px*.ZW_W[߳ ϥkkkKMk ^q׻?/ՔRc-|QWSSG{ 'Rp֖P55ԋ.|}cDzKWWWSPS.3uu]O<Ғ]x'Z"|NYaI4:<2?+Q,/"vq>IFcc>"MtBtH*o-ˠPVTJ5ZlyUf{^bJ&Q*.ayN% uQ#jZ,,rT-_qc_JqٖFtFDw<=G*W)uJ{]{I֖<}@kj͝F g3Toy%jQ_ʾqdRK4}Z>6E̓{d_{LR*]NY"*8VTa;Z/۶н5SetH)llD&)ib55d n{thN[ϕ6+工"GY#@-^Z\CPoRrIoP_NK[rcU#`N L޸PC3hʒ]x۷ި+ZX'C*${X@lY~ZN+˳TYm}(ߟ|tQ-׀x2l${x@BÁ43 d u@2 d @2 d $3Nq0k,[-/ < d @2 d % C ,u-!z[Eo-VAy[CzyD<"V%;о~WsI,#@Fe +\%K˯2.MKSJTBr1+)f0p>̧XK1p> *#G+ wI+)Va>*O1pU⧘Ot**uD"} 6dW9m1_ ·%~oKAF÷eߖ#VYID[mZ#5m ڰ74[oʪ |[b-EVߖ!A-G:>FRk)QV!/Z*>ŷ5}8Ġs·9=smN\3̵9=smN\3̵9=smN\3̵ |?bQ-rAB~GQ)nhQ\}0V9I'  ch%H/ `k0ըZ0D1 Ԃ@c -"Н#+5M8a' 80WXMFuвzAರ4h? z30CQ?""Dd~`, WHex4[?O!-tiBDPJ CNYm0EC+I&&<ʼn.!N&Lܚ"p!$U`` 8]$W$Wl?.2 tD?1̒U9 1" 7r`O=s5 >X?Izbk9qpvrEn' a-y${7ݚe,H0t} =%NA 5XJi'C<$HY`J>#x̮K<~G;Z''ޝQVko 8VƯN_N]Vvc46f "$'+2QO& '~TNv^EWD gI `D՞E?ă]a) TÄ @J> ~#sZasghL2em[~> :x1+cw5 J8$Q&D$丛$|V^k$?FR28+p"@t3?uuJEy'?OWHn 񱅣1$_G(-B]!JcĻg$^yCjvH;km[ą c` kh#gMwJXn>Hvl殡1 `R޼8; ^U,a>x2Wrr#HQ8{s^v糏PWp4og9uB>")>Ƴ?-RٱB|{kz =A|궅<֮HQ ԐZ9Wn5MarR[k[5+H '6|243YLZ帞$L5ez,l- $A׫}9)3j^<쇴 ȉL05W0i#yxE@x-(FIĹr!9B2g6!O\) $/s*O/.zizP/y:6@odK/1l^H`ˈ<x[Hhx:q6 qo3-<m'kQ%at< #[IYωc0Φ$\U?YQlz^?R|n9$:”1nh(Yq;Dd9Yz xe'/+mX蠏pnFx:F20!:ފT4XX=)yɕśFm+X|hn8kt~m%r]u^I$Mywrk q­m΋5GExItM|5xoN+K?o㜤>ZwM#;ǣTcѸ/Flg8zC3 &SX02 \ GC~- Svױv|kt^_86"?nDؾ@36Jt:S8 0˯8QXMD ٝŃ\$ə ;?H"&A68; 6̍`Űxd@0 n_845|l:HCSo6^dC617 x E)@Mgaf$ GOSA_r.L HJM@~_ x\8l0`Hxpt岡٘ϟdC6u 1kE4!- .$arhb%Y_dρI9"dXA,;iIz2 "X0,v/ΔCk]p`+Yǫ*'@pߏe!fMy4h=QPA$L8DXF3d嚟w J.Ƣq_lfONE#d,!pɎG@kQ;,yA%bĜQc<J>0e0>J&"JpIPN4.4 '%\#,6 g8ECxhTy[}\9^)-11~ռ/ 2a~ Cp#^**WKz'A6 *,pmLN!-qd:]Ea:J`-K%Qȇ#C؊$}\L A3*iQ>Zp Hi s/<O18`CS$ ́@a޼ <{ HAU*aIn&LDg!#s0$Q}ARp?k\7=LKho.my (1sdp 'L!0Q*\Kxƶuz{Qv;-~?7e o8;g78#Qv XPl; xAT(&6ngW@ظ?6inHw{@{P/;;4iwޭaG:R[{/{xdۿo^ଳk[ t={ɬa%h"-[$\OpN!M8p!by;p%zM;#7B|AXa 2%lHؘb_a'n)} FN$F80p>]:ve$\Op>#I86|/^#G =0008aiA_cq~_axt+yyQQr۽]+]$E`- fB-h̉*bVS󒪘;`t?xK b9_}0 zo J‡Aߟ:qo0GWX.Mt]0/{yNO}{A5bC$LX4a\Kb'1Ob{Ġ?a6fp,qhJg֭K;\s$ຠ;i׽OZVWL qU_pmr$X=6ئ"k-/}c»r\ #UP`GG2\s?(>Ua87kK'p?dvSey5^7yo>Osy& DeE5Q_4lM_0F 5l7F3..nNppvOtq^#7C'ӳsMxy7zOyoaf1k64[If_s9ݜo0G+aYŬ V5ZleY']N'ڙ._Y_'_pT2bs*;S(O<1yϳ)"J Z/\Pv .\&8&^p\pbpJYgB!eBbBą$ IY/\Hv -Z&4&^h\hbhJЌšYBυfBaebŅ% K[/\Xv /^&<&^x\xbxJYυgGBe"b"an⿎x6?s--7nL@\<@^TQ1dZ /^3;x0t ?É;Ԉmhj̿&fo`nCwzC* 0f\X68'\zXǢr󂩭F/ж}MvҶõ|mWjI^ȱ5@[m!mj[]6ն篡_ckB͠@k*tokC`yh qcJ!W1(^=̯0_5N0FC:̄ Xa%d6\Nkߪm#mhM4m|~kv'cXz7ֶohNmUldQJMvõseD&zl6αqzlV9{UKV{17O[ݎo~7O܂ Pbq=>MٛjOtz6gotgciE?Z{ \oV,>I[}Ө/6Sr"BۨqѢ7w͉:ryK#-:x@޺{ osvw8P.y7 NG@\}=G9z$+E=˱&ף%Ynv¹~0m1Ni{-v˙v]q8`7U{z-v7V{j{{hD6==VSU꩏SY=cy)ڻL6 H\=[[k[k[km٣X_{3~ڃKwM"u:¥ns TŘ,Ts2P{:ji tMt31us>8@>x~CGfy`X61IUcKi1q:-4\tW͜z\jĕ;Rg#;`V~%c#]{@m;QM3׸)]hu =uI-M9(;EhWM siΩfz7-W}_MtE|^T%Χy ׎|:/Nn{W^ݱ5oؿo;@mf;7ۻ(1_||N/rp^? Ra1^9/ȗ *Ww|8k9xwwTF8x++rq}%8xb>oݑ@>2|}qGy1/|o J!*,gH0H+iLWLp2N0ײ 6xUa+vZDhNAئdWShÑ&RmlJ q5 lk&$RB a+so‡榨 *@.bᶨ%j1.&ILITf]񬼫%{՚UpueO::hWW+NeWf9b,_oK_ _;~7P\yGVEUTAVGE*JPzL"\=*' ȧUxHUTE** # j(abEj*Nʼn"j!V(ڨ6^UAp5\UZTU"UYU'ՓP@=i4RT%xXUQU J=Y,z+-JzQ& W*U-UK(ZPR%(U"<:PZ%$x\%d(nJQ)PVVBy5@ '@5*j0<>Vj(5 *1j TV8& 'I&C³ TS3 xNRT} ϫP_ j 5<5^T|PK-T ZA{_=+e+Zm* mC?&-e_W0fv`xS˜HS-uF:MEueuVWUh*cŚ&%k O'GG߿{EKg[{ؿi1W;.VW57@v} xъЊԊҊ֊|\+2G+V$C+Vd$7N|7J+2O+VdVȷZz|Y^+VGbR2r OZUZZ5ZZuZ)ʿHVgF/ZZ-ZZmZZZ]ZzԊ֊ъՊӊ׊'E6";hԊҊ֊ъՊ׊\Њ\Ԋ\Ҋ\֊\Պ\ӊM+VVV$[9ʘr1y2ʜ EΑ"WH1Mo%%&>Y/Vh'EU'zT1PAbC8"c8!NS8#Ίs⼸ .KⲸ"yFOӁ:pQO!Z`6-E' <"I$W$dn`"E|>1ALPHl0S=Le6Eb#FqQϰEWܛ0_伏Dw޻Nߛ XFQk0JkFg>(r 0G0 >Y>F( c`,9?&$H0 `6|s_@| s+_|C_=?bX=rX?JXa u6@ *a lmvN1a}A8cpNI? sp. W n-Ȇ875:xcބySތ7o[ּ owxoyޑ˧|'w=|/ ?#(?Ə$?O3g9a/ ʯ_u7-o b ! n!Gx+xU4ET4Ż'b'&+/DYlMb"mb!v]b#}b8 U&cjl3;.ck3!q8j3')q8k3%qŸj\3~57ߍ-#۸Bs|^d )kڲ+_˲|E6ʆ5|C)ɷdcDɷeSL6ii+wdl/eQ+;2Ivɲ&ߓC)-?}䇲'2Uir,ȡ#9L~,r%G1r' r$d9EN'r\Α_ +rF.ʅ;H~/?r̔K2\?ɕr\-ȵr\/7,(fEnvCnG~y@ayDqyBiyFyyA^u!7--o{ 9SΒ3yY^W5|no0{)f/k3[[=Vm}`>ZV5JY!P#k5ޚ`M&Ydk5՚f}bMfX3YlS3s +Қk}eͳ[XKLkZn~VZku+hbm6[[6ku:l['yuٺb]YZ׭߬M+ۺmln ۰]>l }>m}ɾl__o w}ζo|'|sL}>}!P_/{+++{++++{W777ɗ77777F=^|2GJwΧ߷0o[Sĉa7Eӽ0}p1b,~1[)nuR,)gJFetLʺ\Ac/>>NȲ;G/ 3%<Ƽ]tf%zCz3\osMD@kjĝu㷥|" T#kqqgO?QuzOD\ه?!;o څ(].jۏ%vF~ʫLe=PԝsoUyT 'V[k(oގqxkUK1?ʷ*zHE[ѹ,!g%Xk ֬5<ڲPSY6 bx6 7gh;$ɓyO{  >a#>Fq|4GoOkta,D('b!"[i͘f \`uu="]7\7X~7 #X(X{{{={==Uq/pdmm,νӽϚcnptܠUB|-bK==Orrl'V{*y*5gl[{jxj ZZ,SSii6z^~44bc+&&>׷9瞭jt+lI˵[9Vs㫯˼hm {?.Zb{hۑ ؎-c;Wَ':c;QtŶ=N7c7۴~#f&2[ 6}K 'b{- ͖mJLTb?o-aoob& !q;Rq{h(q_[SnLjf܎͹'o?D'n]-x4qEng^ܮ]#pگu=7o,Rj4nO8kL7f dp{5Z ,6~^swҽ ZC[h7^7gNcMrYsX E3ц{_N*.l&`;BvxQbų.c;Fv8 fXl*oD ۓ^ j9fW\bm6Ar!-ӐVHn$a88*xUp8.(W> JkD̓N}Q]*b_Dt-qئQbo$c{ٞ5wȄ9%`_Osb"nC`1!8OI.lͲY}|;|##W"W#ؾ nn n nna[{:x&bW?*bE|?Ɉ_/ ^^ ^ ^ - - -=Zz"dБscCC'B'CgCBC 0Q'OC3pf8p$\)\?n.7 MM--í­mmN.p$+ȈבKjs2Y!sГ}$хeo٨F}%L>RGҏUWqBqp|s>3 G3wul7ԋ3Ro>7w{|@A݃ệw ]e}KfO= z.<ÞcTHL[T. If&(Ǫc| b!ga S-Z1;CB$yF J yF!O y*SC<㐧 yVK[UqẗV.?qY|jYf)90O鴎c}}i-y|O =滵?#;yb|ՌWaފbRΪFD;&I,Xggϳك(.SF{ A+cfL>sY({,$JKɼR)lϴgR%{}7==Q̾^@Bj/S5a{%h<0xF*Vh49K`,?X!X0Xr1VU#^1f{xܖV@moC.H*u}t33*9Yz.pV9]"K[D50фsYPub mm;\ulv]IJ{={Zx~0c-xݔp[b?1a,{8!Wnz̔'\ťmEV1طqLf5Kj<"3Ҳ9lff[zzǺӾ_w(߽}|iEiƥO[v0퍴ӳ[L8}S?fd1#cI֌Sg3DuŁac3ef~f̑s2Wd|5X0#8#'/pZ%$'4! ԟ> s?\^>~3IV fVYӲڒu29̍t(%f5A۸11Hm @rz:@A z$H<RH} =H>| @x @ r?AYdYd!dE@y<Ab = K, y yă< Q zǀ<1R K=2 ˀ, ˁ,܃ 8ǁVl{S8>Wq⨣{a/w1B䳇$oVSBzmpIoз4 BvCYuB۞Z)hs)]jxExCT*oU桾"~Y%|9}8AV57O]yu=1ԌniL>qCo&Qn>

TͯSEϤR{ bꡛD_Q*Vxi旝boN3(b~Midbfޛ͇|f~!DC3D=H Zt^Te{=bmαy$sFV٨@J-^*Aػ]Uh\q_Б|Y5+P^yɺWuѝû[0ŇceM@*3-GN]gHܳXR苬o}iVܳ)+BjVceSV+LO癣 mu:]&S) f Vۂd$8?zT~LoF$eYN}=g"7>xՉ0an|zg'/SH/ͣR1a$kxjj>,_t*w: ĿtobmᣍxEs9Is?}o^6̺5Wva({LZoOf-$^x>YP}=f:潖߁JRkG;V描rcxYF15r n6wQ->׉1TџF5*q= w@pdl]=Id<[ON$H=UL&Bz\Nb:u(oϲ)Py$|]먜IϲHu4*X>%t|: YCK~Q C{3ھh킶3Z_(`ڟzI/ Yd\rT.$)C@=2IJjr (SʭYc ƐW/ø̢F(\!,F֘uc:đnrZk>%Ux^''L>_?s \s}O'-"+p ȫZeX?3P0003"5Jd`ezL!|T{KQg|ӺtM!QFIwmuu2g&? yR>GXhѓg/F_}%џD_4zԼć|tљ;eѻwGD~]}ч?.>sF}B43{"}Fhf*үT9MN3Ly%]r<*SkKttIw]tWMw7{>fW=P҃uzSeP@/қfE?mzޡw#~NӧiO7>w=@_p8Uj NuF'۩tj99Nm'שu9yN)t;-XX9ݒ5DLjQ#XujbVu4ZRizn<=DeV};-w9J?uzK8by@_hN; S@t9E+֦|Z.7-iUnSW>#g~y@ayD~&?__ʯE$yU^Sd5EMUt5CTwYLݥUjZVjzZmUϫ:^PiuF^UP]QW5ׄn u#]&nn[6n.ַzCzz~JҫVQ!}tN ;YNĩNԑr81'NecWeC~9YȬ2k:Cf} xld62 ̇<&j"3tRL.+r|B>)jFzAn;]|_~ /?ȏʏ'S5JVcX5NWD5IݡJCGjzX=֫ jڤ:9uLJ~VQgo9;u^]T_KuYW Qgstm躺un P=JcX=N=^=Wӏz^WJ~R?9Z_9r|Nwҝ '4v|OatowGLNb?7:rGc&F'f(#lg;ӝYle8wc|d>N_`IbltNG(|Nk5#+9prf$5nr v3d:x8r#[p$_!Kq"]VM5VVTx&fw%k̹Q|DK8S|3r癳㙑l{},4I9 )㠜Ht.1[n?[!i( 4-k-`[ߒr8a)gέ8VL~tX}s|s(Oâà](ʊNNԎΏ'}:;NN P1jLACcdl ;PuTu 709MdxYH]*DeZR2y+n+*05UEL qQ SKP ˳o>lJesقjֲ Ւd{W՝ȞՓ}T_\U-r?[9K!vm}ݾqUfRrv :KS6G,%AxuL]/2rE !Qr#BqQʍ[ٽATuotE[ӭ)jm$꺍&m!֢m/n'vMݛ[3y5#y$(ӌD!3ebf$rHTٌDHTÌDHTیDuHTόDHnY[7tMT4HV6 Xh0ȗyEgxtͲV&.f2JY󸚲&KMHQl&qNRb}h+۲>t` ˛d֊޲7WcO1XB$pYљcY+!'8Z<|c'9.î1'8v}fpL̿82,È͙Cl_Ɵ_rnXVr+WR]W smn b[ݦn31mc6n1vng1vVq%̽vrיִ;,eνS2L0p;[Iu{޸wM̫rQ1Lן>YF"k*5&Ca`oaqr'K7G&sn)Q[[x9I!Qoűdbx9~E#l9&vMqOqg Wq5 j vl?OdWՔ^=)Gzɑ^ՙ4Ѱ>ly6iP%3J &={q[<&pޱ2 y^XW̞.̕*ό2r)Xq[)d^aQ._n<ęg Ky5b-}\iSU@7ptes\}j@9O7,V q } Շ!c!؈TđFjl"ijfhjζgpcwα'6?6n--/(={ĖƖ-'$*F7d0NjYj@9Wd_/º+fK *|t UYO#Bn Y!K'P$iu3lE4yy)z=)dZ^L`3଎gu1Y۽=rI2yiM3#|k[25[PuSWRsvlt$57kgLYms9Gyy:; ;rD=OϨK||M+\ b~ˈefdBXǢ1It,N#cUbUhLz:ejиXN,lX]#˧XXC+5idYQ˜&-UQyTTuzknjf֪U3)Uu[帣?XyEL7W9%V[ֿ}N:cql3g׻uET7"w+q_D;)[}{}\|(73wȝ,gi+ɽ s&aeR[y+^WQGq^x_;eRbΖ9ؗ;27p?m3C3%gYijbOהȬK<(W7r=hrodjV9g z** USgY)S뻬.󺫮S-5Y:suqTOs!4 FSS"Bhtf˱WGs<7b4Q&z߉b爉.saZF 2!*)%~%c5|?08; =&QDa}>q1} "a[-q? Qp^8o4y_tz+L+8XWq&.~,փUDjZ@գ? l'Αȑ{4]}>2G'KY7ݧhAs6dKi/KsLGME}JD/!3˙M?sO߿%ĝgͼ Z`]ӰCXYX2YjXVk 1I`'*DLysut ^OhΜk\w?D]:J&_f*pܫϚgJ01nU;9'owD| 287ux.X`~Y^3hKy)4 Dr*tAr5Pص{+T9^9w]T6XF&⯬rTEQm6:j J5+r8O;Ol.^c@Eݱ_ɵ1aQSg75Ź)RLj\TB*7zSrh9돾AC5yj^sQZyQ"Uiyq}qɉgƃgݸ;T=(^joW<~NoP~|P|x ćGQa|L|,52>9>Zŧ&Orٷ qmWZlC=zHs#M4__d˱Vg3v:9圦!U:b'5 ?O|j'>3/ %?qO\1W XX?+ YV ߱d%k h6t롤e)Ļ&ƤDa;)4hf;#ڤi]TNd;\ GVnN'*MV骎CPD5!jB؃a8uRo~g`R'wfN@\tvAzK ",mPDDAAy "&RA@7w}3d2IIrr9'̣yb8W$D\V!޷Y(G@[vyz>Ӿ۲ i;fE%lfEvك(Q/ !Jfik}?Y`ϐT>[xoOʧVTJBTD=D CkTBTEUʨ̋jUT+ VPUZMZTfQPFM!5S=BSuX͏uPOITgx+ӼyU}q[8?3yEm!%N4&~|<;>Eퟹm!Ah[!*Vm+C*mתڪ>j-iZQ-ZFu#QU'.T_ݬnj!ZMCk-hm#Zނ7f}L@Tkj=Z/m]Jq2o۰c5z h΄Vp\41-˖VɩK˘>8u,pw$@HCb>S3AxGY RxGY(5y)T!9/s#kBkxmYZk*JW2NggU|TskUjZ.KfFBxs@5g!#coi< z3zj?]qjΫt=syAAҥkSZu/݋3[DIjWUAo>Q':` }o(bީ:ؕc^O'sJa+ӹ6Dc[+&ј]w$>m|݃1˜ ccŔ 0S/Ҥxj/'8cq2(8(2J^Tf1-8˘sO]q=:zh+5̼¼yޕ;:8 }iOE9u7.g :,E_1VLųb!'xUުgҭAk5zz2zK9b)V*0-w!Q\)bR>@JRg9oP8+r|?&r!lj\9";1rN )bRv#tLIً_bR>A٘}H5&e?RǤ`RycR~DJH1)!R|1)_"%.&+I)R‰&.iҙƼwa"%B VL#ŋS֧7n KFYlq'w;g>w;+F?@k|yC0$oH|+ 2fow8$F!z;hؕINډ?T4Ww ])U[]#]oHvG`;{߹·dw!$On=idb;dh,>@:L35'\~}szL%ѝ.HZ#ic?NLGjtA3c5sG.9x%q9'xu8?zuNs~5#',xLxó0ϾCv h4 rSsyg- Vg>K_ 7WC̷dɐ\e -hEEA.ZrњVU-jD5V)MS:PsYuN-UՃS/Rvw3$]!)IqONAvNAv:[!; 퐝 ٩,%FF}G_!B_B_E_C_@_d #2ʐT*d qMȈkhgC1lvވvC;;cr;bw}dcjuMfsZiƕ崔hE]. a4A Ʋg֯H:g##<'x Yt E"(H{{ ]h"I@ @{8 Om=5dO`DD9EנKKb BtkCYuѣ[\2&4e3RڢWڡW:W:WiG;]1oh]xmǃDv^v>Pu~PUU'mPB_h T]\ \\ \\\\ \\\ll޼ |(('(7(/(9<??<|+(y,(vP@%O%?J3{l.٣xfZjԋ~*xiP(wI *x*VjX1cŨژ`oƘ`O| ,͙;M0z/ԏʌD|u~ZPk?j@ZQ남u!Ժ0j]6ќ"~"i~". V6hOC7e`։wQ'SF8hJ[ζ+mx-g'^t6:7lbUUM_c~6e;_Yw,'=oYɔ܈9f'սGq݂ Q/?WLtԗw#h,dF3aOKb~->*AԭQ+eޣ;k 9^M1m芶e\hIJ/hȜ`aFmzuG=p[uø}4{5~>tX7C5ljj9Rr$5q܊O9`"'VDb+8ueEO?/=8)%˩}WZǣs-d4KP$QnUu#({=ƾ kj)twh KF:"cWO,GBVqooVYTR,'+TYIVd YK֑dH6ew[r*Vy 4!ga9W>*˅r\"rB>-5r _+5|S[G#ߓcKyTfɟInGOqT0W&N$qwyX>G^+|VDq*hxUViJ𴠼t_:$} *AIQQ񍡀Ld1 ٲ,IJI˲,9,Oa"S(+R!YYV²JW:5eMZ֖)Y֕u/S1P6ⲱlL%d3ٌ7˛%{Q)GҲGe 9!r0*/GQTAc(Ec)U㩢('R%9YNk^,ʩTE> rNd̤!Րs)P-//-yTG. \$Q=|˥r)5O'|R>IS)j,WʕD>#r\Eir\MZr=/|IDMrf^._Z˭r+oɷF|wNnۨ.SC#u;N,wE{/MĝoޥE}oscܯ1]*1 ̌ c׼cW_!U^uaoAo!oa9NxxKEʼ[kT4Hu >?VEUs4֍VGm %vN_PSO↜?s}Ҹn9?/$\nsOK}>ý {π|]\O\pO}S/}W\d#-gi-Di+K; ? [7t34C6e{Jj 5]ԫXw >ZGK̛(7VR2`U`5`u` `M`-`]`;M9c;u}EXի1Eu+Ep|猗q|ހ!˗"k%ee)T`E`%*jZ:zF&4`3`s` `KuVm]7oLfGGo888xpp2p ^}gg3g> \\\\ | 8pIrS>\|EK_nfkk%O???M;w~pi3/_o#]Ѵ=n'}y!(u` ݉lz2zV mi;}}C?Fη'+`?~KWmہw?~7 {k?3=xxx < x p$pp4p VXmہw] C}7v=^Ow8#{sp8p,|Ӈ"P7 ?GxiO'oaދ'3yߛy{tVċHE DDE>{)=11ObĿ:&MLۘw1cc?gďˏm9?2pDf\*^y7q_ygHk(ͻhCpqýnI. 7<膇.Ii 7 rï7 s?7<0 Onx O}}Js*jlOg_9H e)*3:*A%F@IU@%E*BVJ/rTXTTau*6T1U\PרtPeU9U޼Rd< *뉱˞dmOﱧSit{=δgQd?d϶ۏsُ{^l?f/ *ѸՖh8Gt[֎낺.lto:Ytq]B_K[7NayIMzM߮wqz'$}KҺ.NѩՕu]UWu ]Sޱߵ߳W6Zn;`}o-Ӎl؜ǼznFn4L7-tK}n7{}OOg:Sҽv _ azGQzSc\w +0F#کvjګ>Qԧj:C3B}R_oԷ;:~0H::N)uZQFIo֯z~Soo;]ަzP?;.[{'zTAr{<ϋ?\rЕرo["`gΨ𾧤8tXYd."1rxeNa?-͉nsjǬ mm#d~Q>/ETu/oŜyGs& 1b"B̙ N.tkCnYkg+87?7_H"i;fd=nx7\y!m' G;s"֯c7Nte_q^tk;'G-b ፗ%3Lw;H #CS0-a00-a0J(a)!KdMfN|̛<59@sߩ}:sg? N9/ :ĈĈĈĈĈĜ`~..>\ݲd p"p%Iwq$FF\;21212y-ȑw4"zw߉n˜tγ#6gɱ~ZGZ Q۱W(O_wEAAAhiq9gy ?%.>\ |y#O#~q9@s,NYS;eNYS%=Mq}Vp"sOF.?)KԤ8aXO AkcƝ ֠5GUȻy7y7"F݈M\+TwC t`ޛL1箎Ade;i7hbX"\p9ܫs>sէhiS3#ekox"&g93^-9FQqQ <ϙSP!32 \ _{B͸E{ܹsEQn 2Qy1qsTf\t"Ts{TΩS;F+%K\g3)2NV9(}DU 5=EDp- M4mkywmh>7ahxW \|驩388sIn\\֠@vEӝ*/^{QK#ҫqvmKk|DV˜ԝl^є`9gh6w{i?_'p8F%~ q?Ӱ0gS8o X%a81'[y- V~g3+s<`8n[+U*VQsmJ[e8^2vr/oxSG9>bogk OsO sb_5xy|}=9ổc}9~Lf{ǛWAV< I$ JD"Eɿ2k=*"!H+q_ H/`%'T"y'u$uLNI9% Ǎ'{Sz$H$= z3oږǔe£G=[v/ }VkZ1yStsrϚp)C=f^6\ΌH,z %"ƾDDDDDDDDDDDDDDDD$ҟq222222222222222222222222222222222222222222222222222222222222222222222222222222]bA_$,F"z,tG IN=hX&IЂ~͒hX/Ij & {q z' Ё}M :( ЇIJ9_-%|DqZS)9)k8e-%┵DSqZ"NYKFM"q|aq&0_,g4^Z<ˬ\̹H^(j爞hl}>#hˠg.{M׷LU$th؊y t'm#' ZU iV@`;7p#ZÀOO$ 2ʼ;;TΤ? |TgwMv7͈HD@M! "[ED\špShR"/""%\Y @ê?=g]O}?9g7ߖ$0WCgӇ6PYKhvK{X}<8ը5; (=7MF{&f .mAlߪ|⴨.J;P1Nv ]!nBڋ^ ژi[IYK+?-Ү6nc|0S̕bn_'84%2LmLM]M=L}MyHqۥB2iOK+#+Klv6GZNHڗ(NiK{R:im\r>uv-vk}_ Q1fff*Rτu=%J'I[`q-g7~(+z(&IdIY/f|$r]$fu+5I+(uOQ,_KqqR~kSI1eڙ~Iehj*0M'ײSzM[L;LL{LMM'ML~jf0ǘs9ݜk|[wr%y,Wp\'""ME2WeҾ.|?er)6So|giN>N>N>N>N>N2:>hSd~M3 EfƔ"glD)}RHG̗**k|>̗*J-v뤕*T]dgM էkv_ׄBVݺ2ӥVrhAia%d|2jC\،eAkO6{&RNآvF:ߛ:#zc͢S[sAσv̠\~u-mBޕ!Ja5~9W\ZPlGHɭ|?ѳ7Ms鿈gp^Ya2hȓ9;F̝Ge̓g<<9#ɊtJFԷ$i<;dr CP1 Q*OCe6&+d)N'_'>">- :̹VU-Fty!O`#FΟ6vrkRRSZh#̑kB}[یa^1jb m p d(Sg?36>{Zh}NaX,>zк;#?6y B 엦B9aU /c\l'!9lP{ָ a;İc=ޏj\>V_6>m䈰кVVZitX}RX}Gh}Y~S;C?VV">5%^VLiaq?ykc[ۄۇճ]{s}aQaaauWX}jX}zX >;>7^VwՋ aEa%ahteȁ ab^W][ˆDy1 >Sӧ&Ӿb&ļmNiSؕ=qhѸ3W |Em-㱧soe66ޔFY^bǭۚZu͊(-Ĉļ,qUS [J>h*oq'([MeQTRbRڤ.feQvXRo4%-%Œo1҆%Ko*OեwLvF=U7.{-ѹ}pMOMe,(m'kO~WrNo>iGR52Cu_?:\5z{ݧ)gRuJy=e~oan'/?>PAm9;shEy07^ŽwkeyW +ZE*}}<܇#V==NPgA#6Nfʫ|ʴ!bu!!Ci3l԰Q;EE>l%Vd5+/ㇻ_~yDˆi=ΈFNY0O=uy|Ɋcݰ7M4ˬUޝ#3sNl{ι9sk8ܾsK~y歞3= Gn/<3?c.i":g3E/(:\tcdzxV{/h` ,X`Âm ><77bkqZq^5 ;.,\uEu_4sъE7.^gм͢gq7K0՗BWJpnf%4,~aiߛ%lM2u-x 򧑍 KM#Ӯ[:v외*xb]۱̢({8*3nW=77rӹ2@r^deJmd>$w;JR'8MoN)1qER5?oM{pna\{˞Y)#p18c$8Ogl!jQ _7"\zl3Xk%-_Yk(QW5)i=.{].6 j;QjG[[k"w٦rcK.OJxҴwbv1Nf q.iVnq^iVT?+G`J@WMqcbJn@?^yvNMI)x؋.q"csSE L*x8X-zηo,F-[l9Lׯӭ^3XzFRʺ(Wllۉ^կr<u3ϚsR)^b Ë^kW802o8 8CҮw8_C9.k_kwV.~`M7U3MXmY&j$K D8 78 Fq.?:*0렱f>ը!PQ0`7jrx{ssBxc`r^*v55/uyf^( (oFQhFQgPhuA*"_pI+o黎2E׿FяTxbPPQX*i)2+,GOYbgf>fcf>fcf>Zf]e]e]e]e]e]e1fL`xCc7Ǭ1k|Ǭ1k|Ǭ1k|(@JPч> |@JPŇ>~_%WU~h((XDa%[{b}R&H=/ߗZ?[-XI}RaT'I}RaT'I}R:WfWffOfOfOfOfffffƳf+YJl%kɶcD::[lP }QSaT;NSaT;NSaT;NXZd-VONN*8MaSJ%{ޖZdSWW+J@OaS]g=>9"{f&+j9kV}L+ZUzg+yV:UxJ \H*Z3S>s6=M>GJGOY~x`,8 ixf G$0zz_n)*ιgΊ gtK '\'3 ON"}l< "28K3,FȲY#bdY,e1,F=&pb,fO*<“ O*<“ O*{p#aqqqqqq~>mj9qܔ5up7dC' @B7\AA_a@x` !0:kXo;.o lal-_>m1l@DL%)n 쁽%L8y#IڱZCėWA8nphD*RF:!R! ҵWMJ ok~la_{`/49X٨۵Vp;6]ОGEiw7 ]w^Ov\!ڬ@D l`@,A<$@"$A2(ZUR  264㏾@[hwA{ԕsC71;_ɵ>0ɼ4=I0f|X`1,\ ?FT7e]LZ _mɚφ6淵f D@$X! vp@,$hMɠR  2aK;5 m-=5# := }p?<9c=!zAoxB?x£`0 0 0F(c'0B|Ya ,X?">uVk` /u#g oa|C`74m-_>m1l\^/_a~8ZH-Y,RK~, @:?} K*AƋ E"xd2^/AƋ E"j">m1l=>?gJ`7!qDaTD\R  ]YWj^~C;o}Sحh@6=|{ʘJ~]nkedZ'>N`VkeVI6wA8x1ޛOxV>Y}\Jk$SZO06>Y?x5gl+gl'k=/Cpv!*N iZcT:dm {T+ZC{N?,r+t'>=ڨ\mqHBD 8H$HEأA&0h8gB; 3wC6tu2罼Ւk~xř=`0P|05FOflӸ$M0͹2YX.Ű/~y2um7MXo#|Mk*U& 6ۢf&r=YēkmJTAvɖ7gXUƹMחqU/"1!7S®e6wѪA@Qmy 詂E5'jXm}< ? Wa5k~ ï xa=o;.oUܭU # iXOƯ2~C`%kִkUGk_gB̂P/j*⛊o*⛊o*⛊o*⛊o*⛊o*⛊o*⛊o*}BfCG3㻈;}3~o6O>3O%F}3oKKK^}fs~}ƸJW)*e\q2RU*B7 [5 _#3T8O0*FRe};/?tf:+]̮zFW]btU e(F7ʸQƍ2nqe(F7ʸQƍ2nqe(F7ʸQƍ2nqe(F7ʸQƍ2n"PE@"UDT*q~DE\hq(yqx?:=W=s :VG81h#81hhhhhhhhhhhhhhhh#81h#81hDs;"<^N<|'tb1ؔ2O ߏ6112Q8G(ceqVf|wYt2g% $=0K+73k{iՎbX`1,<gȍr 7:ȍr 7:ȍr /:ȋ򢃼 /:ȋb 癌oJx%k9X=EZ%k[ڭdV2v]e*cWUƮ2v]e*cWUƮ2v]e*cWUƮ2v]e*cWUƮ2v=gN "YS=:)⑗p5@mOж msY)v(!̯kWK˴̓D>*6I88%ʪY?=ղԲԲԲԲ}D_%*WJU}D_%*WJU}D_%*WJU}_<1 Tx0fLx ilĆDW%*UJtU]UDݿ3pysxPvѮ"b61.!%jZ&ĺڼ%b_̯cыtּZ; 8 8 8Z:Nn(Er4*Ght4:FШJШJШJШJШJШJШJШJШJШJШJШJШѨѨѨѨR cԱBX!u:VH+R cԱBX!u:VH+4>@h|ѸѸѸѸѸѸѸѸѸѸѸ U U;rߢ\=գ\=G=\{_ն%P ֡`*֠b *Qя~TGE?*Qя~TGE?*Qя~TGE?*Qя~TGzTGzTGzTGzTGzTGzTGzTGzTG%?*QɏJ~TGTATATATATATATATATATATA0V2 Ѐ (@sSm D6             : D4@tNi dF9sxҘ?ׯSkd5YqFV\#+Ȋk$֍ĺX7FbHu#n$֍ĺX7OܽI]0 LT4bbF1Ѥ4&i0 j.o/ * DDaZ#FQDaeq]Î].q=~uhֻiֻiֻiֻiֻi;!ime3Ư"/("/(Lewp7 n~tۏnm?G~tۏnm?G~tۏnm?G,SL2,SL2P EP EP EP EP EP EP EP o(ء*ء*ء*ء*ء*ء*ء*ء*ء*ء*ء*r|EU):u}=e .O!ž[cXƲ5lek,[cyH2\fek,q/3eMz1uG'ߡV}r}Up&9NooVs]֪)Ϻ+º+º+B>Q}|(G>Q}|(G>Q}|(G>Wa}Wa}Wa}Wa};ogL3vۙ~;ogL3vۙ~;ogL3v׺ZaGZ_K{hINWtW7؉!oO-MK(UJ`%е=tkOC'];INvҵtk'];INvҵtk'];INvҵtk' {Cн=t{Kt/ѽDKt/ѽDKt/ѽDKt/ѽDKt/ѽDKt/ѽTӸ{/ߍ_Ē_`ø#7m9qBMO?;oF$.{vkxa_/eά8]k'tDOt`}I};'v- ]4Bn4z1q#q2N $o5}7. 4CӥhFxtt-DpNL~LYO17hOxڹ_zњڝ{k~tnkj<,4p8>#(||K(5z~U7PHuT:f5,SL2%TIŘ1c V(((E )?PpS0O"7QpSp*ԫP/^L b)S*TReJ)UTReJ)UTReJۧ&J)S*TLrtD0~QXHl= =ARDzo ,|vO$B. M֚ '&.J|:<}ID*﯒/J KyA[dNi׌^d8n3ЙP]kkwUc>1u;tCތk+]rz9<'{&m+㝛}yWWIU>4XQ/+ƊJΊJ*J"J,b k K` ,a%lc,`XɎUրi.;W]f2[,/~ }S޵oVwVX^]ξlu(^ yM}3m)/)O0IWͳYK7; -/4+rjBNMȩabH|8A}u}gmfe2+Pwuww58Ԩ0j')B)@NMS~sb~{r=0E:X .M&6GA9Q(S^nnoaGf>yY7u:{Ev/x^{CGL2 /xWGc[{l.Xwuk-|Wby>#FnvݟX]eq?rzo[l@-];Z^cc*}WI"vQ.ޱTǹ~X[1:ԣmǩ$Rx}w"M| a gY|9ua0; ão'p#gY򵉣3\3~ nO}UVW?#o4]GCyP2 e%YxV2߈[1蠦;1S]?ݹ}}fyަ9xs¦GlYln[F2\.P,6=~ٴϺnsm_{8ss#vzkua~:y:xhs.=sl 6zP o6&vTlݏ6nkbs¸fvamsqs)4Gl)܌g18a(eb` !']{?#GΉѸ>f{luw<H5Z-RVgσ{>s=XX$~(JRTxE%%"<'O?-v!]&n㱿[x:"/|u_YGx<Ge\O Sy6]5GMQ/繼f}g_yh_k=m-OsY6V^y'ZšwҪV}c;ǒwg}g}XNּFh4>-wrwZk:_<6T=ל6kym66ؽƮxXScCt?fVP[W_ܳ6*۟b1>føXGrƳ]l 6>mHվ{Wy FwΕZVR0TZJV*U,3ZQj=c=+uŬʲ3vjϰ"+/ѬdEkYcsv5B, jnt+[Y}.grToWZw.g@k Sݚ_u?oU͸ό̮n7>3r;۩Nv*SFp;u۩NvnڬGD9nP+^t԰1:³O-GqG/!*>e앇{~yߧOĽ>i{|/^р=%Om"qb9P|zy_EIxvÞVk\ٵ0̊N ;kz,/:У>iK l>+'}'}OiVn?D([i[#n5VnnOot뇟]f#FuV-:2\Gpj5܀9=kNRj:Yߗ~f[~(H8\{Z׳j檨*jb>Ϫ*jszVSQT95N%j0 cu4yaіE#nq9npeW_~%uogs*nNa%nNn4 4H K4,p# 7ҰDÒ9oN@ K4,EQj]TTRy`9JuQ$O<5S#O<5S"O.*䩐B k쩩q;$#8xEh =~kZKZ~ZG:z֐l;տ6 .xtU+`[h ~~ S؃~ZwL;x1Ngp">0'9 >q/O%ğ/?+_l|_谺+u‹u/`9^Kx+ ^ŪbpWr6uϳX kMES},xtа1@` GwkP5[N+u,Na^q .x2=55tËb8b$Np~x[ Lm|6Þ5 omSCGc{ ~mT6ߍw4C(7xcc{^/Fߎgq`A818xl|_98_7M=Ƅ,w!]ro2\+pUx5?`O'lv^ p71xfcNx®/.dAytceo;νթH` ǧq萢x"uig8·qⰐ,d9 YBs˹-e)eAO4^Z&^L j8c^*בj AMVX$&, '{H#N,'KʼndOH6zQ)uhRT_&3ILV߷!,oĂz?o pk ҆y>q955ШF 4jZ ǹO: thC"-kZ_hksKܢzuAHQr;,Jc'F3 ,6>bl6>f㳣+$v>OboIZVaGgvŎ.K;Ď.ލS:ŮNS_hxI 8~ f9̨? F׏ / 7l$nU]8xy=$ވ%:,x+,Mlw1BWF$v2qa \p5\j5I$^Lkڧ)bͬw3ĘIzŗY,eҠ=aVj86LJxNNS&>a1K%~?fď[J]w;{5,i3x 6opU{kH4\ݮ߄`s<%T\MN>]ӣÌu'ׁߤMߤMߤMNLTMߍ{p/cf>܏cxI`n4|C\p=nI 7܊ɸ ܉)p7ptp𡃣1$:XUյ_>9r,#eDh2YF4ˈf,#eD ȫ* ȫ* ȫ"oJ(*J(*J(8Qr(9.Nk,.p1ߪ')~#Uah:J4%MGi4-EӴhMӢiZ4Mi4-݂[w nA-Ȼy ݂[yG#XXXXXXX&ZOEPzPE[ч AȾXd_,/EDQ}>QTϩsj>ϩsj>ϩsj>ϩsj>ϩsj>ϩsj>ϩsj>ϩsj>ϩsj>ϩsj>WwN4\|!+eeL2QV&DY(+eeL2QV&DY(+eeL2QV&DY(+ezzzzzzVD^U/Ѫh{-J׽,VGiY,# 2,Sfcd1lPaGZ?~ev6JfJғmؒ9,ܒX2\Z+rĺYkE~m{A\FrY.#ed,2\FrY..*J.*J.*J.&g8y1 A<(s9JժjwʢiY4-eѴ,EӲhZMˢiY4-eѴ:3VgX3cufΌՙ:3VgX3PNN]؍=x|Bf(3OYy/r/򺄼.Km N!Sdqi9d!?h!ĩuG"E^GQuy?#gtyE>uk?} 2*Q*L^?h#BB<:#<:aaaa\JM)q43pj 1T?SIdUCQ:d4<W/9VUF6e/T9?*#[­zz*~x~('nX_ b}AAX_ b4ʴo0Q7\1j{֥w(bCwU8iNZ!\{ cUOZ?'bDUAUAiU}EJ-bE"[*i*i*i*i [w(@oUMOV5-V5-V-MT-MS--V-MT-9~N9~N9~N9~N9~NՕUueU]YUWVՕUueU]YUWVՕUueU]YUWVՕUueU]YUWVՕUueG|hm<q{>1PTeUhYZzc}<,mlQ4\lmo0McTvcW ߄[/˨2*/˨2*/˨2*/˨2*/˨2*/˨2*/˨2*/hJ 뾋EWcGԍuc/$ L&ZCkbI:Ԇ[j:'^mVoM-ыaq/Ҟg~IvG2(i|(rWsX҉/yOwѿf6"wD+I'XcZ:euh2Uʕߕ;[]}[\Mytw\#/ie?֟- w_Ra|aNaó_˾KZJ#GӉ5^4+Kg}uԷ}=iDɪj4*u%ühRh@##]v6Ќ?C6:hn͸b2nSLW$ ЀF FCЌA@,KĒ:N,KĎ:N;Ď:N;8'tԝo z܀1pn-wWn܃{1303R0| ڽ![YnWl{N?Gw}!3 K7ص#{Ğ{{'C{{A{_H°d|qoGr\rɦ0$P׍ q.Wj\ AmT&նImRmT&նImRmT&նImRmT&նImRmT&նEБ\VxKc^r5ark&:9o[l@>L'K%~SBKj0$.#5ynG='e='{ O;ߊ62ԫk,V+x^a;vcW|u0᧸7`ƜLC0x:~_+\x瘅 B`~5X,?p1.1===wb .on܃{130~Cl/C&dlX됯Ü!`u7FL$܄q nd܆qL]^L }?i:>L:8Ɛ0'JOěr:ylzty5\]bn{x_:&Xcsϱ9?Xcsϱ9?Xcsϱ9?Xcsϱ9?Xcsϱ9X݊׳e=kYZֳCwy}g~n,͓zw;7;WF!/õZp-zOYSV3zXb=SgH-}JEѢ_e}@Ḑo8k_YuvVmU gYoտ7VXcoտ7VXcoիejYQЙWjв3Voa!|T27Muas󰰵@)#njDktr-~bitdx!:0<::΢Y~Mt>X{):goE'Ϊ}]>CIg#,,vژOy(ac^ ;'JםҺj֥Ui::w|9|p0ٲ1elQuF~K%Tά}Xv9T?ɵ_D7Fbm/Fxϩ=|ٚ(BC4Cx^_r\LŶN]ԞLeWJ\q &Z\ˏԳԳԣԣԓ{oKmj6Z=6%z#n}\t<ϫq}X]{ɺ7O _j>K͉kZL};#:61dH%tqӣOS[Pj8;\3ҪHF5B6 sgA\VWhwTcqpWwpWƮ?(WUUIp_* rxzz (\*+r S]QE<8"G8$[5CG|իUU U(P. ]@7<͊Mԅ aF.\6r!lByp鉞[R1M>[ƒl 򋐿-A;/,|9OplpUc68c>8k-V,ȑ%>0dP PKZa/է}EP}pd[1nD'|߁atz苞 MUڨ%#[Oz\ББx;껉RGБQoSmC.|B8HVCƸ֤X`v0}:c4m6䟍uZ'%P9 NȚYvXDA`B^@lJסF=,PS9z=#z@G}؈1(lGب(:CAa,, @dsPpn#b^lKnu\A"tC|#E089K•fr&\ݐ̷w2ˇ|/d= [/K6J@vcGGMsuk A|ȗ!_>ˇ|SiLn{c}!<MjĹ5 <5r: x rpmVS : ::i373a<5vyނF'BWj'D'B7##3nLg\WF݇IUj*r烲]{6zY`e9 Ak[B>\"NtNH9X2l)8Lp+e} SAL)[և wCAZ`C\h>$s*`8-'[z+(p)b#;ZP(2dh=ދ*9vt^N{!K#)ܲЉ,m\?9^{!f,GsןH7d)>=RE{%RY=J,О?(T?4;tgqsk 4j(ՑjթsP\tG5z $$&͞ͷ2_ZH׵IKbk-m-\s"'!2 _<(3/B j#.h!> PG\r!BIEi$b\L\ou\]v)2PzMU5^:am8_yp>Mݸ 𯂳Uv'\+4ʀLGՑȫ Z @ceM}4ҙ~BI~*I#9mh?A$1b[ύu溣%vH_Q # QZ~,ʧKG r*'(SSpj zb 錽z:`5[XX՚}ųj9@ EqqP-qZ3'xP.d j?E"Z$pRE8i!U]VNj&hj!]]=]hM,xX9vUUnV;=V{Ԛuvz݉Pwnc5:7?.-a/X]Lg澔ΥjF7ߑн4=Fi~}pʄxzUch9`i]؍g6v;v;Xgɺn֋}U|2X|jeZK<ނdVk/r~kvb'~5_˯eW J~3wv~;wwkyޅ]dyov3d`<{#C|4='>c Ŀs$of6}wl&ˋ %lHIl*rQKf D#Z#lT4ekE3ќ-,W&V\%U\&.c ]\+cFq %ڋ^U<+<,s_x )<^|"> b+(yQ(4oNvJӖwz:yYg*|cMglp4 !]/qD]̗kxlw܍|׻;<-pw-^w/E<= ]C*E2A&!e!]=z\hzq39GjWիNU5Vu 'EMP45I}ᤫ9jX-V;j@fW߹k5:x-νޅ^+>ywww:_ MN?]^a/y'''`i9o3 u{#γHo?po7yћMq^vx;8f+qN㌉Sqy-.>.y=r\g\\j\3!Z\31.#.y;tCNSAsa}Bp>=ICΧޡδPPPPdgf<'',ZZ 9u܌xwH,wlxaxw[??$)L}de?@&d?&#d}?N6ߔ-dyȟ!g3ly?O^/7??r?SvWeG7Ȟ>$< |2 tT E ҂t9<ʗA}9&c'`P|3('x9)'19%x-/?&O"<G#rnZ!;O.$f OOA Cҫ1,+ҋyHSzT=s-<99t.(mOPA);ܫAOZ{̲[P{H2]gЖ&UFݯ*u/z RKo.}G-B[B_op)7v#(瞰 vQL0mR-s-C@whzބxcvQBJK˾2:3N&jD-%W/;Afn8ZmC?:sЮ_: nGMM> :ttH+=6^z'aš+e{jʾfOuo ,ZNoՖ7:~OfFamqJ7;f6ޢwv%*Tۤ1Дbxt}ߖYԬS- tڜf2Kt%,O ׇй =2[j4̱e!hԞ?_Y1-G.5'W~׬"glWgYf֘5>[g,Ϭg6wǬ^~gőHHH2=}<z zá7#Eb}3&"-|MGUjV͠8 Y A#; e@~eQ6X4&R>F|jNMi>uh/T d2ꥰz[])?v&B;*_ ͦdMf55jj*VSSVk,}qPhBN)"d58 |+AC;!}ths1g%lpRNSHng?e8u״zn>}t唤PWPX]$GHp1Bj\!UגR#({=I'a)Ph`tVuū#UcT㧒? ͿTwP=jzcaP~Ǩ cuA3H FbcE05 yQD(5 VI!32ɌQ ' 3QM$5 9@}vP}>t H5G}iXA'2mT+JpEjAUPFj*-Em:jچyUnHG}j8"pޯSeu@@Ūe68BGGGGGGGGGG" "nЄ& 4鋸_?%L!LYN~xE8`JPeu: z8@F#U7[o6hA߉.RB4="?b_SrO r!vHJ~J 񃀪*#')JѨ*- q 4A J j5VP:A " C>98 D|+x$`Rp>G#=',@HON-~{ `2`rZt&>bؗdž8}U-%[Kؗj/Y<=k+ұn;➬'gٳ-2z@Έ 2,2zy7aED~žx*"HŎHRQlP#!BQ`ŋ@D R$A2h FTՑ_#*Y`105|#x&@?Pɢ'l_aX:wll:B{e6;_~?|l{0v~IKvA;N:[/0'g-+/[g+J^lڶA$klޚ#{_o=z 󣞯wWD7O|E&o/unAOiܜ8=~EЌSKzIK;C*4]}RgXn0*|P N=t̻z'I m>j%%{^ONWNXeSSCSHGw6(7P?mٿa&{(bL9ԓSW] j;:G//;ݭ#~zg#}kIe4GP W0]φwZAwXIo$-^z/3Wۼ+]yQyęt 0x3q bmcsS^e9S'٧J2+UBSlm7v.Dm~BRwbct=ϵuyv5URE誴2W?`SM y=BPO)VnO*8}`1r}=IRF 1|[OOVfYzߙ޳(?6éG"v i*p%~gP٣̮P{R1"mz <}GjE = ZRzf1q`*}B֯NաLgR}N#_@" R|9hH"m 䊺.S/g}X_@ (J^*Ky_=,aMi,aw/_:|G_:|wׅ5t^O'o<7G>x`7 :|':#Qb|Ɨf|ό/ÿ0t K4t,K/:[E3^t"/6^qnG#<G$o %79e+W~{`?#8b#8b#&8G|O'?#2p\G|kyXd4p/o~x9ƛXkوƛfوƛODHD$F6lI})J$0yө㣨MDC֘P[̩|nEv3Jx`mݑB1zzӖz#T'T  }JfP};,%Ӏ Ӑ5Ƭ; g>lq p:z^b=%ۀM-6z.0/Ԍ bs0P5:ae:6"l"p1pes%}O`?y/ˁ-#߈DY=o ՀRG|j)@ZkYDDx&p:Ӂ?"^tt^x10k}+ u= ,RRP#*R,&bH!P↢Jl(JBZٶ-E##Ǽgw}rneݺtS+ g 1 0 H:匦J+t38o:S3řJ)@ikff?9Bf@&P&]F5r  rLgr1C,7 9Uj5lf 4 nt7R*P|L>iq-|Oi 3LfnƘS39Bs MɘGh9R+c_crv'!/ߤƳ1$9 d ͔S@~HGcT~4& 98/57s?N~{ f\Iʥ' r.)M+<)3Q kЯm\ \ >&oA/ @S( nȳGdsJL%ʔT25W)*SUMjFj,u6TsX5 չ\phjy8B@~+ VAFA~[wHYPSjAU bZcՂX ƪ1V-bV-jV-jKOUu635]5݀Ⱦ,# &(""0"ˀJك HP !h3ϨAowT$_|3o{{SS}ZZD)RZjA)P (PWE:h9eDPm`AYYgvp6ss$@3_>i\\V4f8˃?| c=|\z*WQXGZ+#ɐ-4)R P5ǐ=pOLJBP\چ#x.T+TKjjj#_'TI;( #yr䇄L~DM9!:@Nm&zWK($o*$OOWZWJk5Lδk5\ZW[WKk5B[X׈aC*GhcAg xԙ`MDJ)r04on t5VkԶnfI=k55onG͹qu8 ,.2k9d^a@?V"꯲V! \mFk4Zk|ia=j=*]o6Fk#Jl=#-->kmE鯬zzRR}-W=4~c5Z{1>wOH(}zoBi|'4Q(Sʜ##GJh s"]EGKȽ{?HZDGKWD JT!Q"Q*$*g"A$gkyeD"E)')/$S:Ĕ.1ed?z`f"&zfQLF=0bQ,F=0'bQz3AF=Q2A0ngD&n#0%@ ^ ҆PZV.g:U. `ٳeI'_ v+,{6r9(vt~ tնi;Qnį݉_ˀ_ۊGZ@rrPbE1eHGg\|e2.C>D*\J[4׷6$mL,TCUrX@T}h(8?/*@**D#WȫMcȫu*=%g0ND=C3tUFiȫ3gSܚs"~Fm 76717&n>ha@O >DZI&nktnmt5[C_F ݟ2bD=7/V.$Vv}ۀV#|IW"H&#YXda3E_b 0E/"s9B Vv͏͏?1|'oo@A D &q{<6A,ۃ(6@rmڃh5_/F͎0k46 A'A/$:Ġ.1hX3z^)&,!,//_Zė]ȲؿȲ2Idɿ޿A_>”MvooE+))/܎Y&,;Yv߃^LYv$Dd=(|مyėeėGBYLKpHdYBdy_%ĔĔ)Wh<.ҕ;1bnD] Av'L dd@@WXb2ފx+㭘Q}od3?+&XҋQWlF]˨+ERĨ+&b2Ũ+'Ũ+AF]uQWLF]uD]1ubQWlF])bQW,F])D]1ubԕb2鉺b2JQW,F]1u'ɨ+b1ɨ+&Xb2JOF]Ũ+6fԕ>reԕ"F]1uaԕ+&1 (t!ll*Iiet b 6 ``)#/v *{S+xhEob/_^ IFG~:6C(iaR=LNF7J4pn PB XVJ @PF?44~B1=N55<|+o;'J ODA5Mw<B4 CI( #P* "ӋF/,\Ej&Kt Փ"J= C$C,<,< kJpEt\xxЉበSS@U|Fg(#Da'vc\W;'27*o\FKїhI_u}Vsh aI@S(uu 8Z+?1O{-4ԺϺZj-Cr M')?1Chm=d=0:Cg=-3ytI_"سZZ .͐t{ {X~25¾6o8r9XHǓN"$Jz3t٤sI t Rerդ In%}t'.E{dԽ]v] HCiG뤨wNNd)YN;i8ͼRFPURդkv-W79(zD$3=sNK$R`,OLqQ*3*ii=(+ujYt(H Wp0c I'p.$Lҩ$a C*? M\;H~V50tigzr`~FMIgH9r>ON]TAgxLIC:o֧C{ W<J -srrj2ŷdN4r`߭O[e\TNz6I?UL{.lW|4{=X{F{LZuqj-ù^QΓN]rO3Jw#<1y;s3c\u=R sg_g b  C`G{8U$Hd7N?͞Yo:q-;rϔ}= =϶g98,.Dw0/1{08y/Ѻ}}U'Ͼ߾,a8{ zXj/E2hYث0՘>!h-HŠlD?OAahYȿ'i?go܏h<`wBׅԵԅSyԵE]QI{t RR¾(Rj3sTS>I^"pFLu3|s_ LHpԳqVtޙm@ m^cǺ_o݋>9mwHۡªHM9ybjhKrJƣemaw ~7 FKS}rJQґ)7$GAݜJʼݸZ^L7i|_L SrJ2͔9%/w2ߺ2eW OٕzfnLY=ڕZy}3+/̕GTIW12c(;h1pv#%!^~xؗm9}U cuNXvceo5?bܙÝK}11?kdý;_&Ro#hSmo:9\_߭'C׎ HS!l}$:קv ԶHN zo}^ßm;+甔_wuW^/).Վsc;Gά~LmRm)QԶhoit["b]/V#Ӝ} @Whi9V#Obט/Xd59%30V+GFrF~o#ߏ`GSkR1j 4-O2ZԱvKȳp·|.q*u;tbwT5gjѾ !ic}V8Ԟ`OBd77džV6U# R xn&Hc3X́ 6JIe9QVfcg/8ǩ~FWoF8Ksa, 8Kt8KLr9:{{In1:۸vw{5V4&9|{ v/w+y:Z(,b'Ϝ/YN9d:>1pZ2\Aڐ*$3imI}B%m0MzK^+G_d*=@K2ܬes[PHA럱 i]<\Mك0N _Mj4;]Vhj/=A>G?M>顂u $)BNiзf>e;m89lJiCgjaʾV֚oG[kJ[3*£9~/oMI?:.vF'~?<?p#ˬg蛊ҞfO˰8|ColbiO4kFZӧ'.j4c|K7>CvrtcJdop/1|c|s}^3*Y3+_>]iЏSrGKnjc:mS53-Pr8~'Ч{z`l8#({j^GCY?z{uճN\QR m ~{ J7i GetUZc[jSyށ̦ozZVj 0iF篦aWx$iwiІ>S;XӰM +(ߊck8RkUԓ~z-RLO. Dg I Ӎj>U.^^ ћ$sbezJ`5 \\P팖Xz͙Ϥ.HW*T}[mNNէH iXհGsKRKAz+U R3S3}xuߪ;}geb߷#MHM`jLn[նlI9iNq/1EU>ξZIUd#5B~>)s}#wU޳F3Τ-WkTU+)]TXV߇ӉT'NkOu-[2InjC}sU|]Ud:iҟ$\M=C;uwBב`#h'cօkZϵހk=B)s9b7VhCcg?1 α|X7Ǻ#_'C:091 t1F21nWI0 \&qo<{V8qBf7*΄BZ<+U8K4k׉-WAE]] fDDp"(tyR77I8T|3;A coQx8( 8-w:;tt-spmzs1ee;A_ (zs=zݹw;Q:ə0v(.8;Wם?*̅ nO2}ݾ^^: z{ՠA EMJ)h$财hM,Sџ$E_Ò^HZW@_M 7%/q qox` :{b8$>$Q.:Dz{ao74?ȸz<\Kzy."OU{GUY<Ϫnt|D;"5[HHRLcVJ.%ΙسY歋C1XU%FlDqe_gӚfrXXcr-_Z:r1zczt9Ox:8ea rй \& p8^Vkjô06L†tK ~+t R_5Ӫ S΍d7>{ 95f9]3K#r,oG(zF'Wr˕uӝ nݞDTsNNqfO/a0E"L|&_cDag3=q?H|| 8Cs*GP\乆 \ ܀@>!n[n|7FЍ"sc"uKv==.nn78݁Y y\ | qEE(tc#Ͻ nc݁r!? >;P t;kk^(8-wˑV ݉ u}}w@o݃*³gU!ϪBbbbbb1T1T1T1T6Qi/<'=}x]ě3yA=77"- Àu:yB&u?&kkS]<>0ďqn˨GDA7Go߱{: 'xB "NldZ):+/bwKmUrFlMl5Ico)ސƱ? MY|-MYf,<^;^[ZRZ§)/L[HxwY,›(Oǟ#^&9?s&%)J#t:?X m}X'P;rW r֛%R _L  J.uq_ pSnJ %2xx~ )z1Zh\Qh\I?'U˫oF"^x7񮌂-/%>L|(ichciPeK8iՀOpK[j7i1?M2ѣ2x2&NTSX#m'Q`5m4vڈ8-.Ξû{JN| GXo&Hw8ԥ0i&M%ɠēdH2"dA@X2&NґɢdB$k'H3^~O6J6"b֦jUQɯFUCUowgէ_>xt3ˁ8ʈ6f}աkyݪUӫw=FU*D28DWzjjZ<*qU+2TUS},?(+wP+V 3Č;SF8ٛǚkk%XX mcmq*Ld|QQI:9I-vѱ'bj<ޗb s?eKx4q=K&R X^H0ҏ&RTI Hࣿ`SG]>L bH&} n\7XLGPo^%c Ҟ جkUԨ -^btZHܖXGyjW|&jҸtjܠ}ˤ\~j<Jڸa^|[knsuR٧}6e5q?%ѯi|K/+WwP?fUo5DO{x?Ԟw{Ur[4pnAb"{nne c|1>ú!.1숔a΅CF#^ǧJZ7WB"ϨeSΥ09ŅDwi,l+x_9z;,|F1ssFOÜKu"sYgs倻K/^WP4& *dL JAhP2Z%GɬBɤdCddGdd^@ddVdQ2kP29(OIr 7m?ܟ)FйE$W 愎6S:Qx]kW}9™V Zk&ԌIaRLjF e2Z(sLa6 5""haL>h 0EdD3L) c%+[a-A6?#֓D#V& d6e!jIVJeR Z-Gqɂ;d/CH.@^Ϗhpy9:'mD~7< rWkVC&ZZ͟@;Q9(u!$}BӦY38\}>sE8kqv3>,'|cԖkĄ,>|ky] tXb--!vR]")%V N+G.k>ܬ^W.sMy>0e> 9xy,xGQy|qQH]VhoM0'I0w {=~]7o;>SQ9M/ʰ( {R h=\<=żbkCyb!W}J>E?GŸ&WG_9gY0`d'@++AkbCN'L}&hnw斯S d3ϐb}1Iҗ7zX=GR^$J gkJͶ)f{hz¡,gp07!Έ\xɼ u=5οtCfNC0}PG̛]u5G@ t@]ͫy՚#жg54 i+i+'RVOm E[H6/ʨ)oD7|4/k>|vMWvϠ$r|R!bP8L/::&v6W.,&i^Үr&c9S1pU \2A%iz(?.*uZCX#!md) Q.M20+Đ8|ʽgYwEֳl#t良7[4L5đ؄pJU@/;[K-昧yQ+9tAy~r~IqKaDAJ5͚MMĄ3+fY7F,Mqe+_; 6bĮ;ĩ9qi~%nEۨH :3΢zCJ|MW&mm!7u^!~߳ϲy ̅"8 V-[,]<\3rh98 ^3 8gϿh$"Ҫ:ZQKH$}7?8&$3TѕW,VoIޡw@bp:5ߟ!sO[ښpՠJ!{*mzc0﹧M.:GDzVyyA ؄ߓZ,^A%x,^I;iYY\,:dbW|7,蹈^`IqꯩP=|76u}9# ]w`uO  zߨ7Y=`/`Gp^Kn9ػ}{oC1\Nu'74oK*)r(W 7@UIOģW k/v1Ur\SO9y >'UiKpR| l/Ǖ_+k&iHkzcځt>Qk=lo_wi?>~QмgbLkgؑiEcIڿV!B& /j%œS<5Ȳw xcJ"cta>ƨ]c|3?4?(i-8+tqQpAڨd cϨe[L-ףoa%\(e|GIXoFIXQJ߷ L pr}:٨}:ޏV{>}:ޏxJXIT?o((ʣ\L>-Ϣ-ST@l^wr%uc{uayiG[TЧpQ'7lz8Fe/#bD 嗸BoMѓ\r0&\.8=P= yG'!a>-lDĵq V3='$VޘwOB$wO:Њ*"bq2=@D\VJ\V'hEhpH/xq-r=uL=}/wdBMRm6wOda{Yku ZKXR4=sZKqR=h?吂'-{b)X \'q[j=wOdX=wĝ<)b5qjlwcV͎~q~~1={rTK@ȣWmԬb: \xo^xR$Wi tF8ORH֫B&c>Xܧ}ʱ,Uާ |)dž&׃eH#Ӡw +U\! NɼH{rS.Iw>i5*]^1x= k e}KQ(XDJb J"%P$T^\"Y%)ͧgOr۞;CCs#"yM@~o 1ݸ|?B.|NBǯB;4~ju q|SFóYvN~wʩF(j[_ h11W w<97kd1Ry((|uRYTT-J;''g Ony/Yq %OZ:n:?"'c74?h_GC| C2F^y30r^Ě{cE/xy3!_E ; 0Ch.2p J؝%(aM1lTT(am >3U~!w W*RvWaaTƅk„0)¬'&)VŵbX YDJxMlw{fxHl;)xFω#xE.oDx)Ib$)I RT&HD.{U.vK{RӨp;,:R#Ig!tQ,]n[_#ʖ`KilJy#KQvmY[,[V"fYmvYnJ,D淅DHVokTɶ)A[[S2mdm¤,1ۘmF_R\7OwCRZdĝbOlmQxRlNb/Q]q8!NwiōY)NJi)C~#"JybT iRR.1$IIJ ts~\ bĒ )b~ft8U+ B`]p ~8! )4 n"s~M8cIq+K {_? %= G5 w퇞REN.QcI~~G?Ə׀FùZ_%)~6REoI.&w]ӯU7't . ;V0O]|ǟE2߂~?JHB҅,QWxAHkд"0z\}J9w 6`Z?Gɷ-Qw.s `;b9h6G.#^'p|c:e 9s|6/Kx#o9._7;&~toG1$mX||ӡf}-wxO"ořYoUoȰ):f^73z9f&"o^XfZ,,]˲ CK;,M-,-g,s8dbn YXIJoi&Y=omʹauC^pŔY%ˀՅg,zM($Rf,gl(:-\}5rIJUy$nƀFqr׸ q惗n_zn犹2$y \y6nrV!c#\'wz>sCy$w8]nl.~#)q8ᶃ{`hY-QepGޖcI$]6F=K{v4}ĩ.p\r )ew\. K/5q%5qvWȅziH䚸}\ w4r )8Kow pBr0eTEeOݛ{^4'evДŽcevM0e؉I6=ei!; .KR8-esk<g/ke"|=R>M75r{Y ܑ7'iN`rEDL2ʨl-yiճvñ%˙Yumd.el4ne;^v ;[ZZ(2g6渗Ƒ#Gc' ܉T;g;8ӢG{;=a5y5 unKMeT"%&L&LwMp|h5MϖSaNlo8ojt4t.l֘.MW6m7]74޴8PMPV31o,,sPa0' E 68N"3 b[o@W: 4tbc ǫJ [@w= ZB @@t,\|2"c hv5iA#ݔF"Ux: qVQ1qk@8c 4 0fO ee~T 5a|b*2 @ KxT hXSP;PXS@gs@#$tR,t:M@r1+Ǥs~6@4>eAj^hGZb#$E]@Qe6ofh;Ҷ5ۼWk.~Ԫ+ۤ2#@rݘN0wE3ť e \^ Vv݀{ [ :U' ]Capppppp N?exH>2 dƘ(e2sBĒ~ h7`^dgl14Ov{4|8j3''wƇYS)OZ lZk+!͗"Ґ[;)c baO*6Mf5'?as%zC` N&K멿 (\{S;lH[pl2낢6짖FlkpE\i`5p:nb#.=\3`;x;x;Hq#wns wB,џda ZL):z@/K򼃢kk nla ײ^j9l9b鴜tYz,}C-iU -˔#ʚ`Mj,kb.b>`hڭn@5XomW6YY[m֣c֓^k?u:?#@Q4\HAO%dZWX#zaP, JQ ]0(l.-/k;B# g!p1 7!kp $&#j/&”尨tbVs\|P,E?`Hw%8Vsx%xL2GgpmT8HF<'>)^yZc' -Jf@Arz` ]Y: ڥ8)4i4xA\A.ݔnKҌiFgӃ?Ӷpm=[1 lMk ڶڶvvuNvzl}?km/ۮBxC9{v6e{`{$eU0&5R ۳9\şo/؍v+=n0dllllw{mA}>1ۯI3 $]@٧q󑆗k3ʳזY ʋK ;=oCl wI{ʛl/<^~ (4Z{zT ʯ:ۀ8#G"3#pccc8ePr^GPanou:qt#]Gq1d.#2W vqq198qq~q d[ƙ28sB9Kh:Nim/rp!g=AʐKll칈x꽞[迃8yyd&U3ZqUr*]ցss}UU%FTk"ګU~YS UW5vV5B8j֪mG]_u UUloU?]5X5\5WUUת&*BrqU8-^)^7%؇Rw7[-z"@ 5 xۼ]=f[=== gs%ձ^//u=/ޗc|z_ooooW|lQ@eߖhOַշݶNk|}{}þ#N _ǷF*_;XLtU|wknM^{WI32Ɵ>7R9\%~~?-?7=oO~?'Tniж?kQW >:EvsZ8[1桺\-H}Ct鯮&wѱzuT7S S!98K۫;%_}qOӶ3Q^Q}zE8/!7o#>>Wȣ|Igi8dȣ|`z t Sޅ`*p0R8vvHg{atc1<Њxp)p$Y^8* I8..nnjT5 55өܚ|0ph鬱k5PM}MCΚ}5-5kj9Y][_3X3\3jV3Q3Ysf!_Z3 &SZ7`^:, <# utT n 6zxpWpb3`{#x B B%Jerd] P02!{B=5vBB-T  ¸uPwWC=v>!40⨘tC,=$ؼ`C,-qT_ڒ(KZ[R4W[2doY%y[ZgYjnqll :mss1F.") r#* ${oBHHvv )XJA-P(("R"Z)"">;1\̚5k֬yH 7-|æEc X>|^C%Op|YJo8k_-`O7[?TI[4"jihI!fGZ q; vHް HɰH*2qxnɄȔiܼWM" #U#˃ّUuyD6D6UDvFD<~jhDLUQYeJ=J&T_Ѻ"sE>*VKv fWVWϫb+f䝪U1⁊V'+NAQiemckgotPtp(ZD]{ 68/Шy5O|itI+MѭѽяDDGOT^e&+[ WپSeޕrphy7fTTTW(hT})~VԪrZ+W.\Zޕ][r]͕"g*wVWyӑ +V<bXV,;:^_ZO,76X0VnMM͈͍͊=[{4D؊˱b[bcbǎNƪNdAQiemckgo'xQ,'xWlZ?_*,26J|S|k|G|w|o'#S7M%T< MW$'i`nbl"j0y} O,LT%&N,OJ:+!9-3'/q ihDLJf$3o8Jf'['s>ɡ`pԼd,ysrRrjrFrgs ?\$M>|&@rEru }zr{rW=%&'%O OVTTTTTTTTTTԠ԰éђTO"DjBjr.^RJwW*=$I[sé%d}O-=xjog ٩WRH,5޼ U"-̎'?u$u  Å1qX=9>Tc3w>>7sjbk[,.]SMvCnj7U-vsm_dTGevwgS\;Wר2}>:5M!Qw"DhBhyBK >Z&Ťyݡ՝);V^x'|=t/<[ϴL9 /{K9Y%|ͬ 1? {|;dn5XO=P|~P?hX{ͼXר 6czޮFe2J2JTqF<#.ьFߛeJ4iI𶚟;Lm^>2O&ܜ{ٙ'_}ط͘I,/Nsݝ7Ih0,4i frgNGFFV$'ˍZPI;PIMC-EwlܳݲIap^/c5S~|߬NK*nz+J+{CR-K1IqCm9^ w9޴^,q^Q?ɝwSkWOMCS? Q}wwu="6&*O$7+FA'A h].py_FM[= J]Ir3OT$woP0[ISfs*7\[jK=lK{wM NOr_[ۿӾǍl8I~FkzLju$7mm_2_hk}Y;ͼgRcMLȉ槩-r/#W\'|fֈFnd6G[ddö́х.,S\O.$ȅ ~&-n>Z]U62xw-˺S~kjeJ]SkKF;ig򛱓;ji6k>?z-v>MUd|[ۿOiTYp$u5FEB%խjke5vLQ Z(kYGM=% u?ͻإ>1jޱY?Foyu~Wne'-ϼHσ:h|Ȋ+T%|wwU[0~E 6֖'or_TR4(ZfJIEQUu-,}?|NZtr?|O~JmB"GwU+ c\h35çEG/>Ke/$~=1;[OVSYˆ-oD._4$sfAg(+~ŏ?!>T|@/Kc_ovuuA=,.I" /#L]yo32%4:oNJO“1ĂҶژ~\W$Mߍ1͊^/q׷,VJNjVSҀ|=R{'=#IKR2L#Iݗ$%;ߔ+U_&o4LF{M3{oNLW<:v.M;柙W&=skY{jĔ|{"}J9Y|D֔ȷ'أ|o"_~e"q>crE{b[3cߜ&*:W'9W'ޗ''y1jץ1'T()mTT-Kۖv,Zڳ|W"z,VݥEe"C,q.P:Y|MR:t|;RDEJ_wJʜZ]tw^B='c^P )k%*k_֩[Y~e׊OOW |QPVQ6Q]ٔie3} ]6lسBY|Q\(*sV|C/.}ߝgz1si' (9XI=mkF8'58?Wyy5oo/![75ۃmyiw Vg?GQ#}5&w M#2W9v!o+5hod~L--0<}4fDih4la ,4mѷ~ r'g)txpY#XF8s рU.E@4'BKJo]=w3X؉h5_?->LkѳMY pX2l>.я:_tй|660#<?5x1X b6n3wF`W5!c*LQWod~)G!Sa5BoѼBZvU! hZX5pA ֍;跠C/~IГC6BzTil(ڠ 3{~| \|B 5JpCon }ZPπs'~nMWQ8kxFh\f}9*huf:vn0@ +EGQvKP8=t %ۂ-{!6g5#8k;&&A_{`ϰMbSG3/ہܱo'*jw%9Y,5g|D5i PZ/fֲ 5Xl=u5{-x'L} 6,=buVK;MNuĞW^|Jd_%6D#6(8ذsGq)jm0^N };&YmyK'갉,%eЬnV)\;W-e84v㯆.bˏgXlV j`?m?PJd Ѡ| 6 (d69Dobڬ)=kl,m&ZUc_b8(⻎?ߐṫq b-G;W,qυnjѷ2'OН=`ww @@e@4yK1NGA7,9k*wAk3to3Rg#^I>n ߧσ*r#Cinϥ~g4ryK/6ңmy.~\JB\/Z8ZMhm&e&~i !H~ϧv[2^gr|_NoDݠ;}H9ctR9 Yz.˴v?r?@^4x)xYZО8n4yU Y!b]1-0:ц5>,mHT5 ؝]Lӣ"4[[ňPVEACK)EBӱ$4K_6@R黡EKx-Ub=4(zw 's{tRz 砥)>Z[N3"ٌx'}AJAJtЅ5-3WWKk.y}kG^#)5H]k(Pf@Bh;Sc6maϑz ;ΧGR XT ' @9XHAr199wr"g#̅P]Ir~%oo4z1ov1^>͵y۸?6Sk ƛl/텞oUO} .hf:.ϰMG@ZA봠ѧ e#g7e y'U􌓶]HE['"J-Br>9a'[eFWVG8v\Tvf/oi>GeCU$*cv"Ǜx[LygQ{o؃AL%9 [7>dP:;OJB$#qg!#8 @r㡥voCOLXH#b_wh;TRvppL4O,YOYUy;G޺{R Y~Z$,]ۄ46]m%4L Za5sQ~*A") Z÷H{\8_Un,ws9q{kuo q_XoO8pzwҋyQN ڗݫK^OO?D7z?~߯vE?/P+s/dLv߫ȏ؝=Yȼ 青zpYQxHGhF_q\/ 'Qx<$y pV,*%G ep 'r#BW&|%BDݒ%fBߜ.r9tY='TNWȹ?!H?#=e$F͉a 9(7?29Sw"J;O#Mw4-1Q%@KSMQpSN+;,&v|Na< ٜrmv $/1C<"Xhz=pz8WDg?1ؒQcK[K|oww?16q]Q6(IHU_ Z|Zkt #gGr>͗87s^jqZKPN=ЋĐ3yz4<ݐF8?j_u'g/k*)l!~ |6Q@ Bz$X78/#gȷmZ&+x|=pZ(<$,6~nÞo< kz8Ai]N79 OWcHr6ZH/3,Eu]9@!$H !!0%393Rb)15cRj^?zR1kPkPkz-5j, 1Ϛu^ksf`#*<8Q]E9~>kߵJqKҳyD!ݘ=ĞH6NwG?7 <)/#ZHFe;Np/OR|Gd%$yl&~k=s o?%߁fK,C܃)C_89GѻouN[r 43qp"1]p >}YnOP>kFpS%5L:E< 5NGsa dZQC+8RlZy{༌vNL9o%s:/1h S[.N-LvhO7BI YC '1?=@_N!x9b\~;DwFi£J i}̡q~n`KJhC+"Fn7"% 6oЗK|, (URy0h_1qx/ދM\A<;Z1>|h|?K*z<{^o;ȟ^"sxܳ@Ds}cU7ЯrKmz<8)g>8}0uAOg8Оs6/_MGz.~n}oA-PG÷Ûc|%!1|!"Zx>?YxF$Yjc܋.GeiS.l]g<|قY7AB6zs} Q~1Ey.I7]\gJx=sɇpߥ6p/? y?ZDϥ<+DDsZ]=gd x[͜N _5fg l@sh*|6="EBy9GlBO $kLHn3+7!N{FwT&o@/Bb4~G*,HeEAWCfd6~53(ρ0|/W @-aE"Hc6Co6@t7sϡl.BO9 Ӡ}/d~_d`_z#KK(߁Ð7!oB8? :tp5p x~iqW_D)z^1j#5/ LIhٷ _<::t @tΓ9:@~!Bf dƀ8-}O"“xΊ}аѱء;}t¶m/zQVZ%cƿ/86,X8XS^gMH2/H63{/@3Nڇ0Vs1VsAß?96̵o>>:1&^CCۡg&4!.dӉy;}Q'Q'6I_Ty߂Pj,Jyv%Uˡ)XebKX {{~ QOG]PԵmXEւFC".2ЈD't?X"~"p"p"vDomF]+*5Y;Xq>2[@C{UDx98OS_Y1 |A¨JΨ.H>| Ym6 z@}eEgAC^p}ψg\uaakt3`6̦0uӞ\ < X--؃$AG@:۠ @.лжѶ z@? ><>< â~XVEht/>.a~ >E¼x_!VDd+AX"V?/ϋg? > q;=AceINyПNxE!1 w{+!_ y"qQF$"v}&ưcX^Wו0Y%؞0΂3X|!‡чQD]"#IN|N_4|{iNp<%9SDTJ9cXb,7V5zcFNcM !㈛'SYǸh\6Lfd3gYfgY$22mM5f9׬3Kfh57jn7wf3ͣCQS) w㔆 8!4܃S&┆,p/Ni4d㔆qJCNix4LfGQ:)M) SqJ8P~~ ٻ8AY j(Y %8#8g5y=l'ÓqVCjᬆ0j0pV,Y 6jz^¦{> Y ᬆ84|Ͽ~J,PSfKSkR3{Z+AzK:̞z_g+/R+m8la#  Ϧ4/ 8,2n Cjow[) ;pw po/܏Ã<7$# 'nIdI 4k=qhF=qzvU=n"{!s3,&'zBV,U0n)d¸Meߢt;l"6qY!d~rǝd?!vp uMpc3<2=LDkk-3zBYB374,N,>YYyųQVGIj@Zjmv>Au+M qFP~JApPI)N u3nuS> :B1SL3>KmqRh×)"̿N8lx 5|D# F2*3󍬡cTq6 B:H*cJ!mT!Pus:9ڑ+Fc{3ǔƮJgg8'q8n:۸0.W-W͘3H1m9[D9i73Hqn)$G9ٜG 7u>fi1s9ӜlΣr HbsY\i6MT~]8)k6sj1fꭸbvk A%a[IlZiPie.f#.I|PPoPUN\ \"jUiUS>˚cͷZKXNVYyo5zkF$k _1u:kXÖu9\i p-|EXXIDEҍHV3e _E hOGHi$^Ki"UH-\Md.:*l$;szX Ud)aE>h$Gҝ M]TwU9999'##(]~p/ED5`'~Jcd<${2P=/:S6=Þi϶ B3${#Jn2B:svpF+n.1GvKx@xJ~┽l4Wv#Gv;.53Ұg;I$So v%Y v_aۃ-|$7Zp9*5'KѴhf4;͇\ r-FD&?wuVut[p454#:{%GFDh㹸u5ɜMxK"UՔDG7:RmEn>)mFyC4z,z"z*zX^;b|Rbb顾HA,+ˋXz4ٱXM֨%8g3cpIlS4z6<;8-CئOD <-2|BZfbZk{:~R d5pq|zF_̦SY3'kS+qZ/I5~ڈ3r+m?^yl!YK3O( Q ezg(;=-uZ*PnⅡ|JPJ唈im!Re&TMiVh=9(!FWO1>ļ xISMxrO.ɈyyoE+e Vncy}JOb ]u4bKŶNn\A#N8KA\$\v1 \k2!0~drny*tBׁ= Uj\Buh V .6tJvG8Ⰻ.דӄs %•ՊmaO; 㯃Q7`2au  B0C$vy7׷XLXvXIhPpm:LLhQHp7=ʷBuI"tθҞC/:' ~4 I#|Hʸ3ab^?ld##mFm'#m3~ݵedW ټ[q]S=F>!H(!,g1*>D{Q%,|B Ƿ"66V88-49z ^?ks7>U>iurt{osӮӨ9O 댁s>ߙ)8pޗO]=5{lF`/}ڽpn8b39viRfKy͒0-+uTi;֬rIuT9]uK:5 sx!8zmZWC][s\q|LڷMڷMäഛ$֟-(?~]xhQ'Ga9Bەtǀ|ݙcsO|IyseRlaxbcw\֌I7 fvd1IIo^ry{Q b a[]Im" K(Y?XSvã|P a :(ְE7s3oV˫Ăm1ȸ.s#0*lrŵWb(f/:<&eq+b*k ֙E-Z3J3kZY_:-Fbb֘1ެtn|YXkhYά'=q2BIs!.?"Ξ}>Bܱڛ# 2/B{~Ķ4"]rƜ]"{]__a?nǓY߫c%Ou .\#haKg.ssC+]R)AG^V4d-EkYZkj!֪6WYZ֨6(M[vim>C;֎jǵij*vA]Ѯ¤ze_3IZ>Yt}b^zLti}>(w|ym8>2}ޠ7'~__7n[zxw}_o;wݣ]?{>_,CƻX.N-NS {󇮙ŹzQ~T6my:I~R~¿+uB\Kka43\'%H__`4F^agUN^gw j&Vyo|Zumo$ ~+8G-SJ+GUCRbFQ3Ӱ*W ?CtLWr DɟQ)'XJ\*s`PYBXN*eFYgQ 6+[ (;*D*\8XppP9R8lU)'Sʉv"r0\ T-tBQ9qj^Ѹ {ƩN!*Puvs:"ҹBW kP@ݤn%l'jWagzF˩QqNs%{`oѸ4Xp283ا068VG(Q $`ZMV2SZ Z@ZG~㟊XEL+S$bDͤgk P{X[FX&!rsBnBLkvS۬v`_g6_kK'鲞S`0z=Xج(izW,}NQ}P_җӬ6KUEKՄ5|-w7|mN}sBKZ~@?aeGck?v_H~QLplMXP̊}GSK֎tmOqz gr6XG( O**.½BmSrw[Aq]ŋ2ōbkHIW&#O!9%Ȋ[d].&c3'XIn¯Ƹ~w<.{3-2xTx;} sj~ݸǽ%=|,ޙ, v=X5%ζ`M68E5=`c&\`[p_ar`gGǃ' vOeO\7\^*\RX:~ՑeAITw 4(c9J2ILU^Po'Ǹ&)Ex,zG3o/^ymGDף,]Y, N<>C x_h,9f~~\G ٍ&kӖ%4?JiK %nf,fh0y(U(Z[ᚨv$K5㈌zlQJ~ hO"\K'f"ьhQ.z(5ES]_4\ׇ9r2SC3uf* 3u3f*CbO݁zo}~~u[(BQ `"~Y x5Q`#:G?68l.qU=% ]KD[<1NB[n=l9ۃ6ϠŨ}'VxpCK36*}@_& PG~RXJagaWawD@R@.H-, a'Ժi{ >IRnž0(aY&ߠ4EXyO#a8}?3{NB 4EDpigv^vKBSRL)Vn"""E."Д\DJ#b)"r""H9"'Eڀ~>ϞI 1IPGh>^Gy#Y~Se7oi]L=(dZNa в;~7pc}pnaR XENQʺ(St/ |ݓ5zLJ{uax=l ygzrv;YvCƛݬN;M7@jZuy?vƍ9㣺'Ƨħ3sE\/p``C|s|`{|`s|ׇ%1Ixk-~Up:Yrk+}& $,bK $~7:~&yuÂq,\/×y$x 7JFkM>{"}G%!~wܯ5Z0U0>Cyʽb!%v+%~_/|M6GkʼnN|t_ WEK^>A 71(sT F$Fq=6Q_ILLLIL9E4 WpJV!뭉RƮ^p@pXp,V$NfW'딷5іh+$l- XBJJ5  .)} U2ddh8I%un(% KQd]ƒ&A``]n>A#;.8%8Cƒ󂋂\:%KK J{z K e /(#LzrT xӘ]:t`Ir++z&6=$~tO uQu7P W*/|އ_)--(c˦I8Mq}cesp``@VI ˶J]Kloفe' OU&8Pv*wa`@(B>, G F ƅ9fY\-_@XLt 67 o*ozGn}k*?R~ U 0ʛFFVVLR1MܼE9qbQ },_bC"Q͂\oWUx_(O E_)Dk**x755 58U,[aѩqOJ>jpVj<  x=5׫K-ฆL4k*S;sj9VVn'v8YqRQn0؟*i4 } |01H_8S=@7QfWbRe[{rk# /VFƀ&f+s{Uk}.=j֑w&i&ҷx5φf&+wo3BSLӢ_u.Rf\+!P #)sZ4 KOv/0.h[ o.]F/Mc!]:v*Ӻ_j 铇ny@B>,V)w MigQJga4-1rc;-D*}jf3}Zrm-J1f]t @GNGEV+Z{u1YŊx'(}{ZB񵷒:燻IV.Ma&G7I3;3>swy'§pF3kܷ }u3YzH*K33'?B If qԳolcYGE(nJ{35Vߍ<~v`){$dC ǐIߪEƙyrM2tǸˉgbW{KwjdO}$66 d-%NL>LW˳2 WAa} 'kyp~ ~sG]ЎS2V~FiiS}=\\;CWBO7 q0^6BƳ9$4 A#afBxbsaF´{[-WE_|7 _`|4 /`|1/ `|.o Â`)O ƇB=X7+Ԭ A0EwcӁqz7`Շ ') g%d| Px%0'>qx 0ύOM #; S>BFo<?/,6ocbhXFolo,1Ҿva,PcKX7|c3X7v|cX=}hX7{cX76CkƎzcX76uzc>HolѳyjhmؙmycUؓ7 yc=؍-ƛbv- 2O^Bx}wUFgGWJRG6зgAJohxdz3'Lºe(S +nxְEKm3Ȥi |^M릒W]_;'):D ϒf(w]n.Yp6(zYB hRz4 $r/\H9wjJg,'6Ai&w"=s߇,':Ӣu^љ ~܏@QcZfQx:gZ]ڣIs/ /C+ g1c7CB[ԄyŢ]'14Ezy@)s;3c{Z=~瞂H{2}ɪ͆Y|oߢ- w#Rdvw;dx44eG-ɮGAßCu|{ua.dԜ5gSYM~8o/ې/ <4ϴ{߹6oiAK$Ǒh× y2"yi~;g4F:|/9~eX_@ry7HiQB4?E.Ѣ4J7o@Wor1%_ rE49$m?]f@Ib?Nɴ%B s]6_=wy #"hF]$P w!#aKu'YjU ^ֿ0X?CC_EiƑA"dQ7/)6ߎ9|ӱH9F^by/a} h@/5.hxlB3d.ټɷZa,؃ߤ~|zޤYH9[ibQ)y?o[VU=k+i4f/P 2C uHJvMmeGE[@6!sb^>߬'BWXk͢sXww3&h/P1o6fϺJٱ#s%| ~ oC8{Q|e:6 {K"WgИA}ft#ٿrGz ҖƨZs+HПQd˳ 543?gEɻ7)wj1i9ijY'<!Syy9wyw8DE1ucdѻ/C3ɼxNmeGhy8sahZCcl[m9:5J2O"ctXwN74y59Z3{9531Qօ m|@rbikvCbrQC.4}hh݃]fDJɊ|DӺ1y.G"%̓G5ٟ#<#rf0b!v5[kV {op}j'}$e?*]3&XйgOg`EX6u`4͙e:<]3]91G`΁]h+wF쐁Y} O|9`0v!'zB;F6ANir09Z89Kd:]g3[˙r 1rrr7, 9Ne97?ƀݩ91::('0m'l@r4Ud#rWwÿ r p&H/ۺUϿlH@5|xb΃H+R#Z]M~oZ'lj='c' ~ r=[K䍓>4_>v2:45'w!4k$Lwp߷aD߁| y yKhF"^hc=hBl+S;F? 4GYTtUݏ2I=݅hyWn5 6!%68ǐk h!{,#tAi!?7g Eʧu')@mZOƓ1R^T׬.IKZqup!4&x|]{'{]ǫ~Xw߄*Oi99H1[ PMLS\KHy>b!?=;ҿsпɏLeYWI;SwE{J[l:R֠D'^Kw`LR6PۑSy_n8HmeƺW('Io!.J. WBxjF/_ѭ<3p"E<7A iF%J`F"K.x{ԡRq$W>Po@NT}QӶ3-#Ӻ7~۩ddMeuuǖz:V 'h?. H[ۦejOF~mMv~%szFg=-˨gYH^b.O-~eМ ك4%G)9f}C߂De]D@AӔg.s2$gڇ9Bl3ǪeI "AS+'R1s Hw7_-ZOh/wlѻD^H}{9C>_Hgou Oy~%̌$}GfG5L7=4RW\^әYdIOv]u#6wX,9щtJstnz7S7Jw\ _^ ZVZqX]ߩ^x:޼;~T+yZںd9#[МܗKWRnT+? |\~m-lT3%Ԝ0]ems7nWNӢ? LzvIcO Z גNm\_M[JdSX:tWAajCH¾E_:. Ka`қV 7r=ZPN˖tq۸$|ɦtI:&Y,^71:NFZ@kIovwK X>:tZ;(ӧ$|gL>v dz ^m(+/d %#I>!}əR^QC(Cf Ζ gBzwpVSV +d v~haତ]/7רMevvK/6~ʐ^lsEʼHAaۣyCl2[)ꤽk#R%*.%GDŽLgGeVɵa9ckkI'z3*xLI?tWAavDH¾3`Xfj\+HƍU"iK$^N&B[J.&]'x8)=K¹ř-Eߘ^'|)MIovd] 7 pO-CxRBwM̎ & decE73 i|4@焘/" ^%X+ߜJ= 7}]\ !ed Iy'S* * RӲ6«aتקT4*(,뾕* }+K*S°ӌztq**N̎l̒~V9pfNHm_b2A#|sja Q޺ʍ0vvU 8~)ʋUNU~UwU~`U?!UqԊ2A&jթUc5'& jBd4>=NxSMU5`RU n.auzOԄwPHx^.۫21VgjdG?A0YP"Cª^5UeLfSt 3$~&DFCj>SU K+kWm,,,-U۪vV:TuDUlՅKUW0wXa݆ъA=YVGz>m=sE̖_A5{<˺5w^)m.QtZ(; zVgQO,a9ݿ]~ko?/;X$Xþs:UoPN|C4oH|3yt7vN{;nuXp,kǛ7~ b4C=,ǻ~7~{uF_=ebH^kr~_⧬ aHzR^0+LnO4vT?CY aJZo_?,l7[ 9oWO&'uҢ^_6Q0(oWk96X,c2/ 6ZrKV+}Z0ɫqRI7 )6WmV3%V/be–UZBjoۄۄmK~mw}ٟA8A{[0?-?KS:zN`PcOKs:}X_$i;%zm]/:NJM|-;/Lk1Voڇ$ioEoJɹ[Fs̀sc`8x#5DE$TDR3?Sd)iyKM,}cff\޵֙Vk5k>:-зzE8}} BK3ǐr3)RuЎZ 4k+D)\_rgWy!15i^ռ;L/G9}/gW#-+y@e굴迦@[1^n6م0Kk$F1/ FA\,=IJXM$#ctE2ήs0.Yt]t̪ GS7M7t1ER{Uytuۯ;Rt>buYkY׋>HXG}_}_ﯿuҗKXxxƺgg,**M^eֿd9==AS\??z//|UU'"&"0GXXkhіы w1l`DIClX##c##F YaĆ _d͗5_J!vM*OZfS੝ Jֱrc;β ɪ8r0NEs rl. p#!Wq!_,fsrn5+Bs ;]s)^މ$˼,#Jxxay}~AY,!xK32cJ%ѿ?U)O)׈L-_^cO[ك\l<'$$^\N Mj* ɛH}$ Rd뼤)ɋ8;|3ҧ`=x*y2p~tg%Cn<1) <4Œ 7!%K809's0Fi.q0 B~῜,]{,rˁW.g׿ew|kϦuRY+asab9-Yaҩ%D'LhOGL?yU`wHy,ptz=pO=I3vr866x ^޽׽7 pu-WW%HڛtIG $=I*tOxg夳͂e%TW u?OX <&BIgv&t%t>օf(s6>~rp&4ܟ*w"[M?.s?Y1l(X8.qRbiL/qnB#.0 ݡ'W2NKsF֛1?UOܐ}Bw$gwx ϴpDccYl8VUA~9o启]CxKn$[VB0V'l* b;øwtqCrw_qpF=9!P-H ,Az}}}Y>I?;so\7%@~/hpN}ܛȋ^ .j qS8 8$n:N hyxQ;C[>NձD-o#c2x779(-sA]~ő kPB=@4j&:wh[h?o?2 KVdn?d?.E?]GZx3 Я~]CNwB iź%Pu6[$<(:Jvž^eOu{H_Um2ibt[HYܪ;n "Rw$imؾ;ĵJdlu͵4 dl)Ru(Zm9yԓkkr%Ҵ6x׉?fROЫAQ;oֹ\\3欧x_)ٜ7$W;͵AD^hH.S`JM[+R|n!ؐr\Z7:Y ?(gwi 4iodvW38(` ]7skgnv]B=}.Or7pw Dw!$aP. 5,9pqD"kxAJ)L,l\b|\q-k-krxeeYZǣJI˴T hښJjGkeIW)]@[w+cqg hqqKJq_Ӛe>&!;/8Ow<h<T4y''F~F~|>G@bJ?$?g3/@21zz5='?uZ^WW&1jX*z4s;8pJ'Ǯcf trrrry]ܰܶ\e۱X)V5cݠ!+bffUl l Q>.k_B2LX#I/ERs)5R,k&$;ReQR %3I6,VKjlRn携JY,NGaR'K!,ANr9uf#=rld=elaU>rɲ [ȩ܆ ؃rn6Lΐ;r9ѿ~v>U6z62cqpVgum{Ye.' xyyy9dZ[ͻc/ߘ_"bvg ,V $ӿI:IRd`dpi)IV,Xj+h/9.P 3ԝ5r^,\zP$9TezܔEȒ,H,I6(=)r 3-V(2Nn,rܑʝ&w]/Ϝt13N |{ _ l ܿ|1P+| AYkb&1j4$Ԡ30H6)ơV1kv I ӍM;{3?|#ncuGjn؉=)bgRΦCE<})bG?E(b="p#)bP.] q!Zqvxy  iqa1Z)Fcc11Y1=cC><0f,9M{Y1v`,e,5( A55H5(֠hZ i 2d5Bk AvZT7*DFLUhRٰT >'vj >D(|(3@;_RKeA/oiD*|om4č ooB2*4y]HoC-{kD} Ԥ/̏1՞,. 7$s$boIN@ !q#n4hDQq;ؚ8U,t5& jxz%jYV"61/ר嵈G՚J~քպe*MROJpU/`l-V i^pU=[C@/""B* "=d(ɡt7ICr'H'UvPWxx]UTCL嫨^Wu^WQ=R*vf<6GG!VIVp*I|݉p.G8#t@8aQdP!pVA $!RoPI:/:l$ pGjmdE¢Eaj!mοK2,H' |}j%'8.Fbϸ&oZ&t^ǩИ# XrɒMxلN$ K}t },*.Q;l4b>' CE4Gi5Mi?1jz%pNEwO{> #D@ T~Q‡ Qj~$3t'(AhUpSɪ4(jUUۑU}LȋcNpU<  [qUօS5Er(]VQ M5v7Ž#tj"b}WMVU^?-ݯ">¸đ}CEWq>O0{ҟ爃(~/ q[ c& -\{171jՄTׇuM&Pjp}/ ZM%ge r}_1ڢ+p{%8 AHR-o."Rh@ F ![lt CTo#0FU݀Z!xΓhոDȖ4&DD$% Zm6fd(?K]i?R>q],O@~- Z؇'tGTa+ďA]@c{XgWN.΢P ;N}X-Ǭx"G 9 Hsɸ#~%\o"Lp%M޾E}v6ͽ}l: ]#L BP{eXP#Aw<j7doiu Z`0?1dž=Nmgf=|?&O,ss}.W=f,kqFmq2 yhRy; >qbws1TӘAU$Z\`-XF|r.`5U &{FvaQBTk)"R\sE^@m"P_~Wf9HY94{ KZqF3yxcva?!/ƽepc0UNSГ ~9/jU }/"4`?4ƃgGl K9}c(6Ck8nB0E|UiaWh; ثAG^H{oGauDMGgpU#tsV)HYRor,7zr3[a4ťﱇQ_EQBw$i]P|Nk t\#a46<&sj:(5ooPK~D5 -a|,H~D, u ~Y`o ? eMIH *ӓOx-'塙iyRyR*WJ+y)Sպ&W(Mz{2)+ju:~օQE#|Ep% AaC ZBtG=8>K%cFAXŌ~A'G7xL%SGԼVimݲMMKϚ(X'vSGSQQ%#tҥwm2;'ujԥUPl~z;nԃ0s&rMCRc+;u?t쁔zfΓ o}93}n>ίnN4:g}I{sOTv iGҴ#~<|ydhͣT_$u/λoHÏ|7lZJ̉_~=i'$%w?kQ9Ā32/|by8O<}*.ɾ1#hm }忄ſq:=9rzP]Fr굵7|:ń˛] />Aub߂߹_0s}yKF0"Cj #E}êOٿ׵_/~+imDNRo}Yr9qlN(rsS% =J]Wt)4+IKN~plgL>y,\2zZK}Au"D(Ãkcd>+|Y; Ə['6wZ):C UBM w<Β% 6iO{q޲vgo9|ғ:?~}ң{majq_ּۚx~<͛w߿qkLZvq9Lmj 92FO-8^x26U$%A}q^q1 wzpo#cG(VRޔ-RsK+ ˬI=Q9^e}Wr{+I>bЧEt[1 6c\z*OakOU?laĪǾi]Wk}h.7:2#⪟_)\03eGuez67/KyJьSݞ|c|{eKY,fq>ک٫~jF/M|n17Id^~-s灤0M_wM[r0ɛU?;l'g}Ɓ@FU)>x:57 ƦL 6/Z2uSΙP:(O:tU!OG_\b9 SrՐMtYiEDz|Hs3b,p f)J'utR[:Y[}y^ݹ7=[xclV3d[_] _ML?wN ;'\ȥ+gv?uZz9Ny'uۭ%ܬ:;OΔ{,;:dsV]:"^a ;rӖE\m0qŅO2x϶5'k0=w=8c^Q0l\}/l}xIdYe>痕,,6G'T!71^k~Ώ;mKk}-x!׸]gvڼ2j<;ey2|40b5Hy#2؉)9Nw\} 35Χmve\KߍfAVh=^gnWlYf! 'q3~VLݰ|̈́W,z$3tXScϊh+ݾV_řygy` xhUARZˎgU 5.6!pA(EF]5|^ 1!Aɯ)d+jh E1 UآhE T  [̦ ]{5y㺍WOP9fۦ%i=.$b^m y wsLEc#G/__PJ[8n3g܉x0wٯ蟊ٿwd)NUֻo/7*'MutXqCvP$W&Β8'>j]ždD_C)*Uխ׻G#=M㲑g ݑ& lSt >D%֕fvl;foIJ[QspZ֛LͅJĬ1XDcۀ "R*=h; Q)ǡm $oXו4iCŧڥ,y7 @5ՐC *"A -88N0'ȶIk|P8hrsxG{y)n3qUjZ`d̋9 /<B._9Rifʥ\S E "$Nj*<٘`[49p9q1xT.ѸvdCmQB3|,nq˭Vͱ$SqQ1fʀBh{fSDԕڱГ彩Sx12 mQ>yK{vjp{gR 6Q5*`PE}s,0 )]vg&aCO[ Nbuͩ_1Ol ǭ? 0gcqk̩~wk=E|]u}NQkv=*㳜^ 墰N2rvtەE@ce| 9/3~/^OsJTiņU V\0$-wj"FY=Fu S?TQY N>4vMɕd\wdإ_ï\"P_nh)a/}]J't`E\XAkQi|1 zj35qS_s>q7 U+hmrQDoZ)cV _{D3w}Z|``7x8jyf٧vcI!~sszxn੫6>r8C^sIGVW4l ;|Aog{ѓ-RU _0xXޠu.{ʵ͂jjo!vov!؄Yc /PmŜ;RѺh0!Xo^)W9xM~|Q885V6Laz0vq6Zq҅'w3n, mv.x\Dy~|5߸Pp64k?| S߻1%}K]I,Uu?[ňEkN{KvמwM"ZVKpuPHnBF{Hv@=$ōԫ6^rF96fO3J+?NAJD-}UH+cdsA)Lf,earG > stream x]Mj0 >$t ,CFq}e7L>,}=01ac0I8oѕ.&*- kN.x+;dO3>/7.H *upA&A;}9>Д c5lhFVRORBr'e8q7U}_{n,yJCT>? o- endstream endobj 324 0 obj <> stream x `eLG(IRMOZEPA-*b=@e]u]aU]TقVtQ@PXYwuUoh`~&3f7 1"hEQq>>H$D"GM݇>U"HzF&k7IMD"H$D"H$D"H$Iϡ{v${ H$u?(@r)EmӾ)4Wy6: utQ*Ot)FyeuwI_G9bᮀ7SI$D"H `͝%H=;yW,L|w8tZ+]H$mM҇/^jH$}Tq*U)8oɨ@  `; Ih(aoLapdFBKQh EAcPEC) 4⴯i%@D@ЯFId@d@CAS):Hhh_`r@P*4A3(M2i0t( f ͦt429 .4E#(:R(M9t: бBsi$ ?LͣP'CPR.΀C?ʃ#'t &R zkTLeBxJB+:&i9ttJ 2 }D ISQ9|,s54Z :f@\4fBy ^H"ΧSvRfC/z4G;H4$t̓^F@AirW|蕴KX{z55@Ki ] &uHGeХ t9F^ZFW@o_BLWi{z+]MrZVеW;IAWڻkZ nnDirz/- nA n۠ t;AZCwBJt QAcB"ttPBkM$= OB!FZMBO#?hoџ>C렛1&='/G䂾}^_="ezR{+'}6j;hmnNOk 3Mt'mֶ.z[;M"tU{K}^G[WЃ }_MJvaH2}BoB?]n6_􎶅M~!KzڣD_^B}~(jtH{QSܦ,l¦$lG¦$lG¦6釅M?,laa ~X¦(l¦(l¦ l¦ l¦/l¦/l¦/l!a ~HC¦6M?(la~@¦'l{¦'l{¦6}M/l>a O}¦6}{M+l^aG=hno$[¦6}黅M-lnaw K]¦6};M)lNaw o o oo ;M!la_6};M!laӷ ]¦o6}ۄM&l6a_65a_65a_6Ua_6Ua_6}[M*lVaӷ U¦"lVaӷ U¦,l¦,l¦o6}[M"lKMO6]SƦewɦ6g'8@RUkTNdWL/״ߣ) .H$Diߍ? :ޠVuF<1=eT^!Dg Pd~:N$A7.)rJ$Dҫ!86+Uǜ4q\}D"鳘PW懼?]:?d_Ӓ~O7ԐC=bוH$_' }`*CF@H$'aCp2~HG|8wi?״Ӎ RPŽsyD"Hz@"N)êcN\joDү0[}=;ٻ_kZCbv$D"AC' F1KG{X6D"鳄'~8?wz۲NkkZĥzϡ'v$D"ϬLFaU1'.5D"9yL lj'2NtP{1?$os(D"H|п 9I  A}?[{;J$A燂=;{~ȯwZ_Ӓ~O7.{5zHowA"H$oIB1(0(t<ĥfp Hqّ8]풁B_$u a}7lr~H"WX8[wKNkV5-tGQ).H$Dm:I0 6}oXỷKMs Go`+HP5W̯C65-tc~H z D"}$r`1`*<8<,5}?AB☘D])҃Ǚ~Y?_Ӓ~O7~*os{ D" ;УS9SQaU7R3x#{ -HC*l8CNjS53;]:̟wʖt6y#C? H${=IBTXTDT$ńFGa Ԍa;>[" Lu:b=1w/fމ{6y#0tfowA"H$o_Nb1Q1Q|0gVusR3+$H,9d6w6Q52|'{r״Ӎ!:qaș]H${=IB\DlL\ %y :rIw4H$}PhhxyPJFd鿦%n):89 H$݁E$!!2>.!"J@ ?szcϽ>%I`LS&wc%y]4ޥ#y'1kZƟ{1MD"H|п ~9I? ,QIIJǜH~,Ǟ{}'`K$A d:N|]:MK=?hzqa, H$z=I5ΒdȇGdKk4# .5oآ<f>4k :áǞkt'I$Φx[yxFd6iM>([~ĩiKD"H|п ~9INã9CsJqrhpF'|‘D"3n11%"݌J4΢t)5jhf9^4O 3W;}}ȡ3x\:0E!R_]$SdTtLl\}'M'ODxnVw9}iS㥗4,x.`9M|33rǎ9}#N3,;khfFiR)d20i@bB|\lLTdD9,h 0u(^RmuVt3y^. .+J˸բջ%|SYa-[]٭mlƔJo-WY]Y"BMl`-WdujkyEh%8^XA-A#䊵73(cZ2)Wo/=pٮ)E6[Ufk]d/p"T(V2j𭡛-oi3Smuzl욙.#<-r^y0XGV57Qm.ʣ7Z]Tv͵qB.QR\߂]XZnźU.+ٺz{1O 5_X7&ES}Plm\y-Q'.jV*Dİ&X t/^-8tOahU|:ϸ=Xg ؽNUեT[JO jb橆qjS[V,zn"v,S~U)SYR.O݆$KI:Ēj0R^8bF(a NmV8;mpFN~1D$u$=ў@̜A NQ{)S5mhΑ|z 1FZ\p 9wZSRsV=- նM9h(A}=oTo bpteM):uàYp gEE\G 1v+)~>o{A<o.Ĺe"Q_6ZoˆSZJ캕|xeu|9x|쮫6xnY]z5vsWc]M:d]Q*OL* eBWF%f8+ވ]pEpyL`&Bwӝ9yOsbA@"50ַ&$y|(?T_)M; NֹS,Գibun^]"QsfR6XfQKW/UkH[[3S=qDtz>,YH'(!fێ>zP. 0U5:s:Gx "5[z&"fB̄ +ߢf NitypDsʷΌA3`z0[19ssɐ'̤mt&-x:MN~OrFU֣g©df-)X,laFg+R-UJ +J+ \K.cٹ-VKYYE%Q4m$ƲޚZUJ]먴[^G1E~zIncĥw%.uWiy{ģ&TrDX.uIKEUUndW*Oʢb4rkd^Y(6I\\Ԓ) 8zNi+@[eC1e R Oca] !& !^@ /2ʁ-Q"{ݱlӝ*r8XXcʤy`h/Q&'/FaZ:>Wm/v|ټ8>Գ~}/n1y^_m/Ȯ5+lsk5ֵ KuS hl1okmRksXWVZVb™U iQaALq]IG Nr \&8ϳpP>a۞wX[&H{J :_M\-J6-M8ym奮>-v9?P9r}cVڬ5i &';&M^˳9Y5:ⰤY +gr* s.]>WIx&y[2+yaɫ'x Uɟ%p$&P\$>^<ڴoH#zR$P5ZebuZ,5ORrYb3|E`WzaaaAo5d2Cİ°°"@n^`%EC%8Ȣ*E@cᆰE酕TckL +_o \+OQ3 >J4Ni3 ~_>ssR&p} ^QsD<`U#53l!ĥ1#ԘN3ﳘX"jl$]PH6j2HFDbTG~p}G/؏;h6Zk2ZIhPm? >J(zfҥta]J{X)0OCKiH|VNYW2/\LFwth-4)t;ڷi *vt4]v'-VYt~w칝dlWz+Zi2T-ԯ&+t6 6dT6H+A4fѭ{썝t8l.aM*JZEh#Ɔ)UiRV6g5yZ}i4*U,o2X69]+!cerX=B_(MSh-y't/M}2J. Nle8b+FT6-gw66{[1(6|ԭ껺z6-?45w`{h f,[T*EXT){ԥrݷ;jl"z{3> fFv=_TuKܯnPƧNs߬ذ5 -`|@o?nwU9JG{@;GwP& EOoD/1ˣ87Ћ })L#>q4d]cp4Ŧ`e:ղyX%W:v=Z,wcְ? X6ayeﳏ bEP)YBe2YeKrrޡVeST5%=7կu.C՝NMC[6ssl5Gdl,ɋg ;QȆb 4 KCe腛.B? CDmbW4 z?B,3љ3sf9]yFΗ\ĭq|ϯO^ ,UaDz}k_qr^M.<$ƓyL7s {n ?ᛘ̥#?b&ϙ xy0AYnF#acXGIv|l`&@ `Nm<\\7 osF!wᢗZ-b ܗh-g r#N1лL_Hj l,#E0 0! mw!? Pzq3dLFā璏|)1{38 sfw`$@WpInOQ;C,*ߡVwa]r((KA׌$R$c= ⅓vS?-  Q-7bTa4bC}`oes 6t?[2o+NE Cm>weY#\ 1j&ڑ#׍A]#,7&[Lpix= (%>@;'M뀝G9@5 EO L?Wg#Ft$uhH7 S'سaW,9 Grי7N]]]]]]][oIbHAfB ܦܣ2"qsځŌ3LYs`Vbȼ_*3b`a!Z 6/ڬfW.0\ i7A6{ { ?s`9 '/!7>s~~\E䟿G@'pN? "G`\ҋ$%ayqlA:VcNk_!)-~66[mp*A]< EC{C =؍$taqĠ>1} ļ|r$~@^=IBnWM-( ٲs& ?EG`Lfꍊ!+*΂Na?w};n,),H3c|~(+lWFN*n O `pw L~!`kg hԱ&:n.c YR:iyQaDՕƛc=Ȥv*g0Ge$ΑA\IZ2颭X]lk41vZ[_T}')TH3AbhC gڨUJ]Z_ho0>nIzNUVˌPO9 EI+4 {9A7F͊UAq%N8æ.pVp:cGq5) ^54[,otjGЭ [8D O #yހmqsL.7ìe% n(^ VѱuPzEJR;PEx㌎^orHC fЇiH",\Ss''obWVzedbmƩs~g]ꩃw9.l}Tw` S+vEZ.NH,l"N^;#@Ũu #pϑ bf3i5 38}b5̊1kn|̚ݮ$O?6K:)R)cK}2tN7@. ÜUwz*\ *؝N#Apl>öUũbx 7l%oޙ 0:0K/$_{ARpp:k6a3WBK4Hj\aOoX~]Np`?K֥{{֐ qy7od܄%u?k5V Z0y r[xQ7qe "̱u6ضX[ HA!%#,I F(.l'm!w(/lC"Dpyʦ<}KȭZe-AM'-VWQՙX$)}wCbS.6`Q=b4[*0 TF V^4/!kjjf:}}/_'dzG^ٽps/cx ;#[3Eͼy;v5 4|dRDrб,VaY\WC6$^HKm@3`Cwԓԓz8~KwR wQlOۈ͝v+u*o'!ȥzJC!2Tkȁ5a,L`LfWja}b%i3|v%ĶOR;aQ}A2Z &[AIohJܤ֩*8\3\U܋G"ϩ5kZ^n۱_w_$ծXjO0wvh;߻usܹ< +}sfݲ} x Aif4ɨŌS `F5荈5Y`)VAcaޠAA#6>#y5k0OiJkfgeS).k)O3XpMmNA2RQ`{,Eꐻ2iv8@f˛X 1Ku :cI|:gQKny`2krT[W`=}3zJ-LƳTM1k۹vB#i g/mv<7~<=916tiF0TPbP1rptP(l; &16Aps:O9C8@^JdyDHqDцHDwQ|~O2#L%:I@/PbE]L"3 zеZrm7a"E)zq`#ϕ h‡&l* LPow=T BX`o0F"-kc7,˷lݐxYWܷ粧0|ľ+>#|AΗÅۿ1/PUݥn]eV{1g6f+ym$yn uipPf 萄8JTP*VQRSR'Rl=%hB6em6`sמ%f˳O13 PC= t|V}zUeu|Č6h%zW jQ]|%YC+Q tQ5qY}gnqLL%SEҸLnc\kNYڎFL"ݍU'd4JXⳓLԔ"1lBg^.F7R1[ɭA[fiMhtCr/^so9r/>},&Kbyj3פײJfMW pM&MkHЫ GĠ 'M#.IA؎$7nIlJ,X}rVA(M$5 !Ip˙ca>O&F2[|oX,Lt S÷X l־rxJje-ry,h^YG (I$ZH#]c]EW^AK2u; Ҹ}7m7$ZFeZ ͓Ү`>ͼ5710aMhᏽj2 괛f\wx0م'앧7o bBټ$Oľ|UwOUM_8r[PՓљ"d~-G zG!SG:NJj%C Jl8bW$zEwyGž?h2mD( uu KC2|jxz@Aȋc`}B!=K}X/P;!(v f3BrV=G? ӃiuΔ˃!W8<GMR)װp7;G~YP2A3Hk Tf=OSd_(MB! 9#'Im9eU~?lJNk6O8;} \gԂu.H6tVGLy8Z;/t'3=2}{ҳ{m9Txe*jF7*,{iV5!fH Nqu! !(B&C'0/^[+0u GD@PjX_ĥ01ջH%CTo܄7[C'mĖzsW?mɋ&]X'3xʬT,M/?LX߾NsyαdJ]KM8!ECڢ[x X~݇ʧ}*(jA;VXd$Ip LsL")HF@A,H`?< }ڣ8lZq]ݠݮ%ZCOUöOE݇}hm Sc~\?Keslued2əe%R8X5ڀ{D"$&">eDJ4-,f$H.]` % CxGv1X?t,ą>~4x>&ԣ(C=Cek4E3I{6gXuJn@C2IARZ-sxjeԎN*y橅hdڌ;5ng$ї^Phd]V63FN1b/:3G7ҷGN_!/IcS1bS𫈪7H: ljզ @S5(,jPPHQ!צԙvE Cc6r_|VV+p *㜺2rVVp \IEǽX;1[׍yb#R !Usy ㍖HcXg3kdÒ옘YzW-+YQ\yQ"&\;5~ #CFgEPty82FlS$Ϣ P䡃݄~@{n kgB1 ~&taٕœ$0?Xp쑱k8 b?5ysP(| k5"8zV%l$ 3rKJ 5栅 FUh;z^hMy.W$_9ՠH/mFژEBM͞g㿻)~y·v,fْguKʬљRLf,ʃ)eY<6(ZPi܏zGK:$`пpƶv~]p~}?yjPI (Uq_<9z\չÏd \7 9X]Jw,U_ކ|7Tл} 8<jwe;*@쏅l! ~CdB(xQ/9^\$xh[ xo]_I0"%27D".31tz;0@ABAKo,8  R4:I _oSGK5+tLrIfl=sHݬ̇sYhhU'5uWT5R+%ע/%jBMdECk@m<5+H-WO!1, d-bdd=q;{@2Y¦A^0{+ 4bš<:rn`;*H:cd SaCx\ytPpśf(8%\[+FӕfOqR>4-w ;2r L#O@Α.^8rĠt 荧=,^Ӊg``0H3Ã֢8Fp{dt8{vU+[2](T`f0^H# G܈_ t.X*-Wp+_Y[hwg!yO9xb/d^G~T@+zZuHkOhdOo09%(BRRl*l[ Qg ̺藆C9[zLL\h&o6YLMijzwJeu-AiV]4-|f<̜Lts{_撔ب)--!}zFsEk3 ;bqCʚ%^={L$cfKB,FD҅x:("FHc{е\D4eN?bVs$`Zt~Arن@Βki܀xz`@uܨr/˔CKCVK ?^6Rmkhtl7\eńjO[y}&%Eid'%bFf/ѵ-*"n *Ivž.46Zקq>J Fnohoqg=ϵsF!{|c, hcl4> @B!`4bHKjO*2+2HJReqZ%wmP˜kJEU1؜ˁN gU2,6C `Ka.\*fw~,kjMRx5m>ik`DI(k% yR#š^qɅdbv>2|nfsPP)? .e\0Ϗol? e No'x#AH$D$!BY&~FmxѰoQi ı-@p=Q43"| 3N}U4w;&jd^y|0+ջQw})FwKߙvn/O+Rҁ$x^ a[/Msec߾All!TG469Z.{;:u^{F 5z(`>[u ŵظy'ϸ|^_/Vel%3X IӦܷG+jsf\:f͉!b`ėrrD_&ԘT{Vlvn.%}^KzC!e@h;g83YD!oI+™C sbSZ"Z\b'Ĩ]Ky٨3=q~9W9K{MVodcdkllqYMv.]N5'-LE4"PcdXlꑌK`xJDte=B98S7l^}oKULҾTƁdn7N T[OXLhaMBFl"' rtV28f, !X_*9qÄ͋ ˶:ϋYd< 9gݜv/]Nj-^4-q8-vj \V_#( mP1ƝuuAf+i4X  rr=_G5Nt0tlI3c9;+ 7z386-C%)TpTPK_']m4+y@g)5wszx]_ &~m'|'7`'|'|'|'|'|'|7˯'|IOWtX-,%k/x-AjzykC3{.E(7uqi9iMޙ^^&">>>ۃ3鐮Sc:{B8RhR)f)B_^ ' 2O!C`U8O e%Y:_(SGK`N ykdJWF6SI|w!Ce u^2y]:Pu.C ;=o}VN9*%)Qm͡T Jp#-0PC)s0G.LPx$ %E4 (Fܫ0,NQE*"|>Lsa]*G\ R+mVb*ZGV(Cއex?0b[Ҩ#5C l0M:*ak:?:%XŔz! ?ɎjÔ?H*i\՘LOI8 Ǥ"WK1>k*"- ٪sʭR*pS)_ IRHx;54l%c]C\A:KR?B'BN~%=)1`XJXKF5\on'~Ґ:SˬN.Ҭ7*{i@=i'˹JR*XzZ*HaiB7׌(A])*l˼~}|>‡3+F4/>ZPRoWM_88X-f&R{BF.qNq݄u[>Uq -cD"D9RXo-azSD5WG'ǹjG%6EJ,%]CVaաk L)5nZx{516j"Hzy4gՔs +[N j-[hk9rwu#sHuނkgHS\B/kV\%䢱sy֗ [-ګDdV4Й>~nz: ב8#dTN7g z\(wfCK{iw_>JC὏ZQqKYa^R_b e4s8NxCȮcuR^QF4:DɱZ j1^-$A9͈\V`#x<֑FZǠ kD22V|B+YDFј[*@XUwk43> vA_/^[-rhbl!J4QԁG`,S1e8(LJL-u(ͧ5NÁa!Jqb]l/S%TkL#x92㜟K(W4|&=ubalP 0mG|K|aY$#^3sN1:i1>G>[ƐPxcX|\> >GvQe 7AZ=ţNZ!d6#dGkXdTL͡prd#_a9(∪-Vv x$>,!QL9s\61G| Is(W$!zCکQ=>} izk /f\ԳH&_%OW3Չ'\:+jqs|ǪY^, T;rU*w@-tש_ZTU.JWq Cpz]~uD *#,N;Rʎ)sqI3\~WzZTQ)scԒN=_M]) /wW &M jkjwZUj*WZpJOV>v6m\{hfj_ z,Vاj^ Tl\}eAemLOZW)Y6.֖ WWGxFRK$;pRr.M;p" fFxϲ߃ꪽ>Wy\~>6am60yJ&V";S)`2W #W6`qc<+=5rkϿ|Ü#qzI-cw5U=W2lܯb..N9{pyk*97](rZwUq\(+Q,J.O5 eYSҳw<.徲*dEɌ5ƌV-AsGGRXGFu`%OR7P7aToQ [ ##UrOnHM-(PIUr D%8q8aks-hWu&uNU0Fnj쌛*(e,R{**r(i*77CJcyʠW73 [^ZR\QKbGтluxV ƇԅμNs8 բ\5pze~aMYT))Qj~A=? gUgc"jGKJE*oPTS++qh|{sMw:s,8̟3ߞP;Jrl00ׁ:b,ZeSSYߜŎyN5ȞsgY9zS89U57Ja-&z0/,/*ØSTt`Ԇt8E,G~ HET +kVcfH_sXW /yk}5K^qЕra׆v$('(7C+mwEWUe}WWWWBL!# 4}IWm`S 6C9f_`ei*gAΔ#@Ke ).L)UP ʍ`T(E 变'Y0(w0]]l9o`|d;0ǖ%`_ʟȵYhD/V ܺTQh4,+f@9;SpSSNY+ Ê WcxCj<6f ץÔ[RnA~}oKM)ggbhmq(4 8F?L ?fyJ˶(>r3i4=a$RP^~߽6UK VãY00[Y W`~_) ` ɔǍԓt" z!R$23ONǕ*{9O"f@o䦘Ȅ`hYMޤ8Px[WKf R8B'^ S»).c wR$(|(Q8ZYpwRx?RQ8ORp5%ջ\f{&}?@$z߀st1 s)H{fȨB^ F@]a2GGVϟ`2Li4ƿ$q6^!FI%T.VaitL:.}Ό, eY6srd^f(7l732xRv^_JޭۚnwSƧvrOzLY#/dA QЇOSn=}==M{ /݂f| 'u\oA'S9ZF&R-t7qA_ >߻Ϗ4OJA76{{xX [..n= _O{aBw^pֱNp C=;r<)3ݥP `  Ã<Ó.>A^N_L4]P/)hKzjAT݂>%As+4!0+]~& S"7}>%H*$Cp-li5zaA#BB :KP!K&AA<# N ?8DP \$ Ajɱ}h)ͤc:=Cb m=$!!C *zHKLP/e4D[/XНDŽLJ^g2gq%x.eW/ 鼬 *e/jA+ *Bk 9|( X a l0ݰp ކp>o%dҥP&MfJْ@Kp}j mv ^=۸+:!}.};#3ȆC> *г;KP1c_cA}d uZPaWGIA"bƎTsTsTsTsTsTQa?G&xT QyDŽZvl 8&9&4cT@cBnĊh A"W"{Awĭ"Ov|~[uzC{bqemX5!.Nyq|&45kׄ&.zzzck$h\0yk7!CoXo}5!|Ѹq'ş???=.~x\gqqS7q丸9.ψOOό_ώxa\8.//Ǟ"6{ߏ%.{c?`}\O?(6}=(| c[??g[v'98 -[:sVLˎxJlڀS'%ZJUjٱǵݳv4QgelnA?+ۦg˵lYԜIg)M6Hn]V\:znE1$Xk1iBBj`m]Y'h=ke3Ja\O$Ur>MV=K7v/GtGzD؅>JQ{,D[ϵZ6Q^!ZV'EiztVV6Dڙփ&IjNKkܵ|0PG6n)qXG CZ;Чn7rjm[ڶkk_p]\edd~iM9~Mm;Sijۦ:{\'Zl.ZVg޷7ۚmizpJ xecx$s-[&i 맧ک<(G_-XݞP3ΈUהsֲAm .^6h.._;%wc# jk/jZ`c6ؙ\sA5:޴A?reZn:N[=h. uNkM0t?t{;kLy?Ưij+mUt;گ)<充nNs׿SH7w.9F7!Vmx*ybJ=S]jϮ>(]$ {4~7`lZ9Zl3 ;8ܽzZג3KK6Ybbp2[fmL*XKEHћublzF嵑pג=).BhWRC[_̎XO>ؙ]ѿ} NY JS{wa92r #9l+ _ rfTcd$H|q8~6YvUj$"b|G`C5ZJ7LUgo9:?9urWebU|=Ljuu衝{­}Ky Ot8drOkO?O 1 zM:񝕾Ӆ.gzE4bO|Uό.3tv%ͳlE#h[i0sE].8[<>'Nt^Yꢵ6ޝڥڛ1M>Sj{Z^c65҅0gU_j}Я!xuF?G4zFwFs# uGAf_2EE }%3k!ҴNrQ{mqϫe}]AבCϯYVşuuJ%߻u589Ntz u2+bnètaʪ.U'\eS߅ZF_ѯ0ֻ\,99NwN[zs8~n{ds^Źu[GF73Us~.ܜ{ _wv]y:o׷vXpT^^^*ڄ YVC ?>rAjWûMr*3z=n_ 7u Jcj8M.3id{עJo<;_u?03 &9?dׁ?i) vgw`Qbs5+ٳVvɩwAZÅ5cYv?D-1?ሔ _5+js} Zk3Ep6E6o#O>]u'Jp/6Z*n:ֵK"u}C!\j@mw]of;5{RojZ \˿7h dv=Y܅zEe]ݭZoLt=|oJ*onwOolON}Wftz7oj;y]]t׼w݇ޒ=C广ɼc]Nyx{Kdvi&.Vgq1u\SA S_pbw6tGN}lXyYl=9`i])vpٛsuײ vt:NDߵSwZ~V]Ge(_sK1gh7Euv=޵/1Nqvetwu|NOfv?n ]a^6w%ZOsyU\۾ = &8a;O6E{=2 _>nvnǠ K0= 0z$p n0 C Dћ`>z3,A%-P e`B ;B^}x ؇/<}I HF%Yad,JR& I`4HI0T-a;w0RzZzFIIhtlQ(^^;;0Ng/'`)L-} `KbI0uc2df97٬lyl( l0eJ6M6M"v sUjV*FV*a [j`-[Ů =6IA6k嵰EUoo;fKC{{{{`[-lGAm]xH>. ~""?O'1T`bT࿕JwbRL"+ {~J2PR*peՠm/C^.Vꠔ]v^Fv^Nv&; ;_Nv^Iv!;_Av.wWWWF7hdd+W?C˯&˯ jSh>W| d*V "BDH:% qsf(q=bD? #R#R A%Xx1nTF jAkhI)6YcN+1ė _n$|e:Wf(3LUL \6(W(Wm,ĠuAs0F$ZH\ģ[61x!ЂހbET>*ѧru{N̄S2- y{r C[ ^p?G?~^_ F?vvgC /ߣON5k4V8iZN&j9Q$i4N:)5£D&L!Js !Υʬ8=YOąTY:ǣ.g,!e""e}8BfDl ǩ2Q`(pȕ.f# c6`$(0B~4Gǰ1ST 9~ZNN]E l*!Tr'$Z@Hh!bĠ8\C;5K k%YFX")%)#)'qRV rJfn`rXIe*BjB"!Q !uD~B!]Ǯ 3?ZdAXjY-N]O8UO8ug]B2zQI ÍF 7ɛ0j-!MP7QS?B0u3aj 0iyooaȑk !M\7r&ZG0BuVN'pjmSn!pj#Fe2n'ڤ VfĩEj2LG9ZݡTFb Ǭ; qj f©V&*1fe2LU.A#&e"fBM\rAu!׽\,% FLuk.(YWa+afe #,Kz+})G`T^U^dM-2 ᒫDYXjb `ݰ ំ)@3@I< RF]!V)AחO GP-O[Amh; C\pU#~ pɧyrg R].r0F9wr䏹QnqW+u*wԳ-opKq#}>-[oposo/qpVM(F7Mc47M̾gk¾״5E?n_\'_ݺ77be;rpx1SmZ  D5'UHQ)q$ρ(:`ʸ*y%)s> O6(E\Gh3Q}צ W*v}6]䫉j;>6-_muQW~'_]ԵzOT+k!|oS(E(Ek_4/Dя)8o$?)R!ƾJ#~bb>_īmh[!_TiY9HK(>>-0N,Ϩ=Q?yӢRܐ\ν0-)+DP0,dt*鿡Λ7 CWc=l/%)T&d~Ik{y)yIL-[|Ff /DP@Fd۫Ƹ[Alo!\LKƛvlDMZq#R+!8whˠ z#ވD䱰֐bRi 눓#ꦐ.7z 8Oy.-> eD ,D/U},Ɉ#H:XDQ{%4jo!cfaas".&!l(e}þչuVEtK\]S5uiJ-_7]]΃_ "Ġ+וu]S5HM"5!;QlӤ.[珠&z~EAt*isӁ@+ÈY|/zrB=>'GG!G%QӋ]4g|x0r]rDMF g[Њ;*뜅GK~ī ۂŤERȬCj: q+oܦٍSC7@3 #f/C{o|%;Q#75>4udmyc4Zqca_bjۢ X1(Ѵh34ΰYmFAӦXc`6iw[NӨᙦU٘iG1eߪ1S) cnnVUŰd0=ҥp;=m07wQ;m8 . ԰P`c+ Sp <fT+z 5U*}zP$NұoGidhմ0dk= CRWcbngvW4CFxFw7x;ehkZu+ۋ>3z*OOOp?9]!uPUC͠[?C/Ps5.MM~CME#w"]z6K^:wz)<*4fAw}Siu e5㦍[ {aMt5QݤFf-دh$o]קi˷8 4ѵkڥR ϟDmί - 7"9-qzx,>t{5uc쎏=6?5uxrKA{'^ :a]7V~~T# wrEm^y\+GE5-S >N) kIFL|FC9/Ghs|N\?O}3߉S J6rPڸ65\ @F؉ͣt-܊Dq~_*4NoT%\gxv.TNG Շ[U-~O[۱FnǓi.O}}@iӋ}'h_W>tz$qhЯL~Fp;mvF(uѨ+ǣQ`=gv4`4Ov-o+z_:_S+R̼m6|p.ޥ"8k@6j ͅBKz)3%ee첼2R[[A#e%P>Tv8PVRFh,J+Ʋcl/;e'NeY>|ŲKeW zMCeeM1yXjJW?Hu5F6::u\X^XLJMbh~ӲUW6R9lnOC{y/)O,O,;Gz|ϿL} ^Z涁WP%gKKJ:Ko6^*.PJ[JKQWrO R^zPIkW:MV*M(M)MRzt,(5X],-)Gҋ,̗.S_+C~ޕ~W?HFi2#Fƕ+bD?e>J+E7e# D:L)hO9BBC{B{Ps,ʈX}+;or';XLB,}q:0vLJJt: cZ>4K+,henI\}qۮ:$x2Z8hے˟C_x5?񗉞C?4?M׏+Z>wg8 t`(M ;Qd`sp5#F=DcZRA5h5F9[R Ih A*CpUMȑ<"G`Hf)!M wizyn)}`_ ?#4&x1@(P(m7J9 P)-PP-3g#1i9Ɛ/fR7w_<}G-ey/EzKi-I!ύ _ y4b>"vCȟ9|ˈ}Jc߰wʻMPZ]U_G ×?2i sWASVZ2%ʁ )M@{ߋ>3&"ů'ᯖxBt﬿'xg= /?{Ǘ=T 1Թ ^#g=6w;;yl.O +w l5hݔZCʁ A6R9* 3i=H$dyX'8W E9#LS),4zVڄFC[2 wB"Q:KDm;#|7H&G vzg-ad5 pN"-BW jԔ^Zn{ʸaʰ' Ыb@MT U<|r- fQ)\nW묫5yGQ .=kε nB6 c1zĐ/Ec0m nC]>$?qvW܍bk*w:`M֐qNBiׂ;^/+k7UU }_^c,)O݋ {{bw(O=1 D vy}a[0 RT~Nj;#TTPVPʥӄ2E8CᔜpFU1bH+{GqYzz(6ŰYs"lÞIyjشUϴ3<=O4 Ox'=˛ek2u߫wmo7յb7!7j`lڻ& 2~)"ֽn{D)oQ)xۼ69QA@w9.߼#*<ƐS7 mcpCЁPxy wŻ]^ބϨ"AE4*2PLHmr1QOQ;$#fi^4-cx4Nil"}')|ҩs3[,Ɓ W.^wW܍oa7O`!N~@>|soS@Æk Ȱ˕J\x)\Y= \`qUz9>\Gk~o^sctkQzHMulΟ _#;5nh3(lAs@1<sK/Cˮ2c[Oq(&10rDg ZlWHk΍@:E`ː"|XXbS| VJ7 j@kF_G)6i &;7-{{A_A/X(#(a'i3b}c?5%W÷c;;=pb\=MxxD=4I.0Xp+ })Lq(do0O F$PhHA2XIg<@vK"e0]_Lů/~O'$wI'~D'sLޝz&)z^>#F]Du_ӭ],C6،Vun2 0~ [_kPč$'~wx%Ǥ 18\rBo}ɟI/ǰYB j(L&\a*t`/eP()E?p(*ZAEUtnєg`m M2pԺlshK !SSϟo)x GSx1zm6D+LHQ-3yHʿ%x a6f[?^Ҝ.K7~;mc1Hw#SSM;o|&o*5jZV4m:4&(i>޺x-w>C㽜vU M[ji;x]wy4hx]N85e?o|ʛmH>zVKI#89AzH/9OFUr% Y d3bvs9 r\5r\7w':tUnIwIK/H}ƤIP 7rtOE4.Dn8t9%V!^IrR;ڟ@&gRꒆ6iRRT\O䧒%tH "וsF* r%YKds.Gm#5?5PPAh;<7?3?Fyμb^ :yE||݌qdJeGn('Yj3_F<"G;hCk̽a#Q: J4s윈}UUnj_!v#/OĿM~#a9]o?YKv'-$oK֑=ߤ`w[B^2<Rh@5P4ǀv'94߯opƁZO4S{;/Z\x-w jS騩i6΢܇x`A5]Camkgz#(Y- L %+.31 s9Üi6MfmK̇̇:sᘹ] ''@~ 1"51XnK2f,3Yo߁e=` Y`+} +M aĜt/鿓O!V#Q fwcֻY/+֕jieZڙ2ʹ3-:JƉ φuaٰqN1,*Y)+x0pC,+b,N']]*J8`!XNt$5CwC?9y*1N;$!>ʋIHb?&#y)韒$%3-^=%XOɬ'qRV>QI عpg0 8o絀[,L040 ڥhfttѡQSoo=UΪWaF ;)>DYw뙰|k/i2CaeUfcZ'Ycu Y3֦řmɶT[m-˖k!6AHYlol଴ښmGmmil ۨxv[ݵݳ=YlsKmɶb[ў`O3{=۞'U)MvmK:ۜ ~b?&Lە~~~~o?ohbdk\__\yM}33dS}ԾYfp%.;A.n-cc#QQ9*UG8pt9N98z!ЇWct4uQtt\z?MsŹ.l .sPl*9ENNaHΐ3mmr'&\"r;]_Qn c|zrH>'U=Ɛ/KB|En[-7<.O)yFg"!f>YavkfᣑbrNf& IDLf&3)"RJ"RED H҈h) "AJ"EH"HňRDDD"M"R C <{u^{^LYUh]ѮSENE̊+[IE*FViULZ1bf܊.XUbMMRQ[wVum{VO8Tqds Qc4#ڶ,3>-xN4Ofh h"~SF(Z- VqgXњ#yх%b%âkn<,xJm7{0z> YĻxqǥ˨ zw q b}dnx?`1.>2>&>,~_| H z|:/5*))%r2^ߎ1ӈ?}E`+)%Y[Rܞܙܓܟ<<<< HSjkN2')eN5*\`>t~ DCVف;?TFƫ@  <KU,iտea5G-?V2_ͬSwj۪;#NjzXG>i}Jj^T/;TzGݩ :PgUzPӵ|5KUE;/sy\i>-+a0Z͏og-Ck}GooV+߫W}}]/wV?jP V-~bޡS-״xd[omyF;nWY-3Zfly1}n2ei鯵ԪvV9VZuiڴnZ_ YPՂG?Ty _[ ?OUW|b\-uw^w5R;jEG7""W!<I5׻7]{\dh'dWك7gNeH}wO׫[_TQr;jzjjTaX ^^j?R;j} T9i+K"YΑH~$)D#U~B"OEfD|EFVDVGE6F^lEvDvGEFDNDNEF.Ł;w)Zw/.YZܻ8^.Z`B_I\EM"\zrR UnPZV/.i"s@bG O pϤwRR| S_)!I LkzJ)]R|HEfqLߧ& e~ݔ']R6=R=Io;Rvd%)-%q{m#m A~+|( m7C]ax ˛s N9E? 4-R׹聿b;= {ϏS/5)-8M^eQN_VU֯i\śTqǧT,j;CeR&MIie3錷-1<R- [PF˓-O*Pb;*wpGNV߫B,^ ^K9⡌v:?ZCW|CbtvH0vHB|o#+:ϷBp/@~a(y [ Cx<K8>]I{V{FJIzag 'O[#e5)]<ɮVmxv)K72ď&M]<-("@i)OyvY§<˜YCx9@k() }OhUԼ;!gl e#\J%meillGpn4fvvůϢWbY#ybllMe]F:lJ3H8O;yD.bA%(??Qމ0+γӗ-Oӓ-W0?W8ۨ5ЅrxL|?Us(\2-ݾ-| V}Uͻy <ȯGfZgBfNݔ<>QDOLq9e~nS/sWb8ּ[6F㏀bN}(,`2iO4d%0\`= X?)_b !s{q`ó_۞\>eӟQ0i+d~ bKU7ZIF$9ꔯ%C'ɧ/S[Y1@լ |ơy\[B,1K٦ pe[';yv1 c`-SOI ob.ӕ'=71nh S`7P[ uUve}?fzo=߄a$j8F<[#6:\x1V:A !$NNY(AJ/L bw+0z2EO-8|샆wIj5gvqF[j[R1xj5d.p?K?D>5nh$^bZW/ <%R5H56ƺ 󗳕0o?V{XkT~wql a XOP']d g2_` қQ>YI zpo&Kck_g|K̑e|/7xpa{zo$~ 59vycGwEB"Y&z t%V%vUňU>}1^ˈcF|G3 5 րФ=1Uo?jF#bf\Xף^ Welu)8]Ep#l>uX kt?rsr`tԷ u\8jv@qYu : .o2WQ⚈bQZJiQF~ yt0yBxZ'r_!Yx4U2Wǧ<'dz%<}&rѶH 2hK>@V){>f&JOsc5ouyVMg.in]p> ^ jE#F n.PEs7ǼLp_ີYyD7~b`ƃ4xr'3^Em&+6gW+)'uwYDPwۣƓd6.OizO}|z)Ǥ@\,'O`u*@ ٗɤԓrcdPv5r}hNSy֔Z ACy֒<0#5'Ki7; [k\:/LG׽=S\Ԋ=ێ ),@1?Td 2 0c7ҋ^2Y;ʺGJ:X:8H9( rYΙP}̟As͡52ijH3b|zB]t42E5hkXӑoCz-韑^FZ2:\I6y6Ad\F޻Yn>}ۢ#fPl̀VK9DɻW+K|%֑OqNP5IP:rn0ôm9{o'(g2eNn}trҫ<E<\_ (uD;Ά%|z~Nx_|siž2kI|ׇj0oƪZertYzp=b K%;wUMuBeA1t)dGOx& V5mmɶ;Qj}ޕZn< #qmGkdݪflJձvص}sZ?ğfv>W{-#RH':pȧ`:SfMFF}8#gK˾l/-HQ>G-!s}=pƢ\0ZJ$#~bL5FgO,S?D?g^7,7umGklj(+#x vi$J@+@-yzg]Nw7?Y,1Npjd*֍?]oۆ֍Hyv>N?I/g!ogAs8| ;H?N*Ɩl.ΧUv?RHsXa4V !یf.s\7Ҷ/ x\P֒B7fp4xf~֬A?Ξ>(=P5Fdgs*KL0M'Aof#˙0x|Պx)o1ކx;Z-9R_t AƄߛYq8ZK!0+ 3c}['KMe3ؚ7ҷʑJ[g3ϲ0R􉤗3̵}BחsIRz} ܍l 'u9{uL8. gQ7:gHygHyrR^#eG5tGWwS+qf?γ/-2KO p:#p+iF2 h7궂|8{9=5V/.pvSړk8r%)K%&Vw^mw,''nW8]||Z}BM>GP8͈7o҂0ְFhR ;!>PE=siqiw짜͔3r63LAfR˾C^ߍѧ/9y4۟笰sԴs-rtμ<6J1gQM!e*)9ܚQ} ?gIRr͸!s*3贚d5g!s Y/s{7rn!Op?%nG? O2뜥4˝+Vsy E֡+8x͝rVOibL mgb{8C zw=1} /$gG8ld8m #h297͙^{"K H:7X9gkȜg1j˛+`qޚ~5K ߆]FRw\ xviPw.p[.pEl Y;kUͤӣ#=HYWZdsKbQaGO6>aDuyƓ9ߨ|[,H3>}M{;kp;CF3F>jӝhJ9;K#cw2*Nd|G3e :c 6Wߤm}5ԟ#=sulHy}oc/$qr+pq!8ޘ4~BoL;BaNt3z%(f6ys!xWو^BQO|V9G6_׉k{o^[M+S&|BFvrW[U6?oQ[/5K)O[c5VwuNi ? ʸMEVI5%p1&[XׂȜ`#l!M8_x5X&c"3S0=c!恔v~H|-riŵI.u5n``7,.uCpYdY< fo]e=,t0'n_C!>p aC: 4ŘG8{爗tՍ+"AO* 9Nsz%|+M0/~ _Dd믣7i2 ]9tm.!$0M7 z@{QZ[6JW悄Aq sˑC@~ᣗy{+77k8n| -~~!n7{rJ[ǡ\@} 5t()m+m%K'$|;V9O)S.@m#6¼9ح)8}viGY̼?'F<:ygg6yfSѴh֗ttW~ӔsDϲ沬G<-o1ز?dSDʜH#9z ߕF']\?eԄ1hs{X;3?ȳ<ILj/'־־!os<)?3lj/%1# 3W y*SI9(gy#uKQ]r3H,`)_h_F|ygqJ6($IRaWiJUUv?{=a)4{=Ǟo/+$vk_pt'v9.NWq;%No'q;aHgqqD\/_NW&D/-w*RTZ'W)Lvn,Jos*KNM Qir6C3[!5Lb=JMȵT[(ѱ+:v Z\r2UP UwWUZNqJ%j#W[Wo~V{jj$:r]ɕ-CRյZkJV avg"Lr;a'6ĮGcoOZ=۞g/{n_k)_oػ}ܮ%gH .'rx:Nhp:/;%2:"FkKtK8^%;)ڮ˜^NT꿐ișT9w3T.kl$ B UK=D3-V:@;!4I8{3rJT)r/HeRJ(wg3Cv3Ǚ,rW8,:8XƦ%9/9[NTBErtgwiϠAs9դaZ4s!]Z9Vvm< bNAk{SNb.]NAv ^Ч?=[`p0=`dmhÜaɂs Rae+ /T`{΂= -8Yp\AC%QRD fkxlǵhzlqIMmU [`# 諻یs {^op@p=*Xm/ k,WX$|Dί Γ7}apIpypUPppCpr]r ~h ;NnH|{BPVcs(7CšP/)ClBBCCFFIh\hbhJhZh3.4'4?(T=/ZZ(1Az`P]hGhwhkPNNy:E a=]vN.a{$[N_ZĶqN>yې>HNxL>P X^ËXK| A wNHL5߅7k]$DpC)fH[ض}aQ6ՍUy"pVX*,/Lzp@j*[8praMP~# .,\pU _fp}^[ D.FKSx½8%^_Lj;FWBxZl#JԮ̟& 5_Er-k\Z'F^ߚ_'v˵Or\OI9z)R*)vYn;WW)-dYjį'MTO7zOʟ?KgJH $-N{,YoL{2 } <iRgeSmR&=iS\/K)Mog*ggzuMO6y6Xf2{^g'uOivm֦.۽萺OOuOs|/鐤iz6t}t_t{'}qf3IIU:TIњԐ?6о7W׽7m}{zeJ3$iaۧdvs/v`Ř]$ҲrI I}/exy/(7Q{dI5EI%͓q[q mʲ8^FCT?ggcfǘ_IĐ& \ו$I$$1&4II$$Iu5>z53眐_z653lsZ,^ .K8,Ѓm;h!-eϵNX1<:l##j=;nڤtܛ~,Cy;41'3~6ELr\fFUqg&;fE96pZx33"̎Wf-9ОCg9Џ #8D<5LϬq32t.=J-ǒH{5|kqL2V &saĈ~1akHj.T¼mثqGjN$aA;a=e>smmQFS1n*])8SMsmaeBd~]gA¦1x7'y x.#!=M$M89ݜ!!%abOU1O4/H('qg p"1!n|rК@Qc:- 1[2@ `o61́D*ƕE1Vu\\_er6A8q'IpYˀ↦>hꇦTG=i{𮖌gΏ񡱡90y7T8Lތ.~@@FAqhh.N51^=+NX2'qo.տ rtӒ%893i]gun8NOo$*.~?Dݰ'ܯ%4"X҇\0oJy}6zLGr#\sqx9W2%?@2!w@_GG`tҙg«˞8ɐQlG.P gi\o[ZdA%wE; ¹9H{'7l^^Fn3ݗA{ZZQf#$8#עJnfCjH}P|cޚޥ~YN CEʓ?\~cϭUR~!E ވ=#-r^:~_ѧ+Nh85=9]7#%J:s]v8ʝ>A_9:Z[2-&1lۭyrx*ǃ}ػÆ˃(s'ݕGow 1tԻǙ:oq[xRx ;(_23zȝj.GްǠ@۠d8^H@D=`5Ʋs3tk(uijnxF < 68|zhLn2/E(\IԚOQ?뮨#Q<@A]z)zqC5?ցDy?h[GB !&ПArG|(i~\bEh :OS|~O~ZN,HF\I.h)ڹt2(wA@r(J!q|5-?o?3$aZdz—s?AKG3RR->YcWr/~XSaY3Ż)?}ohs (g4 )UU>L#EC[ w!v̻.<̒k{K>gQw]7hRHչz <-J\i/lug2l&9QV8Wun^qnaqn Iߕsswssc(HZE3N;XOWx$LKIߪBù-ƹt-PU[Z0sss tؽ88w88Pkssw {epW.s!qƕFw$VSpÊs p]5}t*aeV1} l4oV}/G);rjX˰ ;2|a} be7X7س {2H#| sl] MjA[Կvo_2wXuw֤Tʤxj ԋYېgElK(k+4[skQ:e؆S7`v*pt-&m1zQe)*I5A@:tCK@@K@7n 葁@O*&P44;44 hƠ٠Aۂv94w|1ㆎm{"A YAׁn="A=zjmFH j&V1ցCemLІMA[q3-h.=@L-:iAg ]t6ݠ@=:,StACIc3 Z 44T} ~.🈹=?;u/]DΝaqFQcƖ'1` 1 ~w*FB#cc[y *.929u*.d$:s9d4gTK(jEB%& u;;'yj06_|湳9ilʫ@(u^TBd]+UĨi4zc(1JA'Ɖ9bX#6]8vݵ9195]c-a8s9\f3{ISݓپ4_oooookIEUMQ.]s9NGC5"\Z+̯REG~5F;4dUϡn}=mm]i\󵚗jCܚ4OWk$Qkh.89&==:}AVt:}]tV4?Z3Ňkk׈|?_+9czY"mڳ4:ڪu:hFݰ^3ShkD}g̑9G_??z/IύINgN_n,"5\9&qLHtEcb1h4)&cFˢgC 1Rݼ%1vFh4ߧN@{ u.Hh7R*vǴW r%j8虔S!2gY*7iSs/9\Ϯƺּٚ}5$XBb7joo|MO2o/3c1&1~inY(:Yߘt~tcјY3yW؊;7Z_F˧4LK h j~ki>Gs tOf͵5;\?͎z5yC5wh߱ivllW4Xzh+urZ"_.N+-;YWhvTeg"k|-O[KXdW"E9- ,rH[[m"i,r("?h-"GE~EiKϘ2j˜Ж7fImhvMۥL[c/9x "^,u;J"^ӱXu, T~te^cor,s,x"ސco"x""D"ު"$"jEΌ8Vw,@oر7U'M']b5Ro m ]jj\R˱˟ȑ -RW[HH}X$S[m,mKEE" Eih4i-r,T[HsmzƴԖ32et,NO+:HoQ>/^^¼f{LOk'#Uޮ: n,PvsjH>FLD~!R?F1OfӊVYEOWEEO*z'0Ǯ^ŲtbW{;F+4B}] PFVhCF?VhSF?Wh+˕Ee˸ȸeZa%W؅eWX}^DqI,Ok\O2d3-^!f5y"ƈ t8ǖ_P9@#cJ+s*1 gՓq\igVz(MߟfBU0Sb~S‚d*] S'x:X"q ?+[7F\?k.ug׮p:n7sײE.WWaTy[6BvMo&ϡGTԉlWۨ6Oҝf6~&]FTKKOm;RƽmrJUK#$Em*R\?urZTSdQm^Qm%%>M7W}}DrJcowE~s96\`uUS.N# RF[mf/OOO]_]TL,Q+eW3y/5SBn^۵vâ+2Eh(Ib"b%戹bX %bX.DX%J:Alb.vb\#8*OJyZ^#uzy-o`9\&G;?=^y*Ca|T>&O'?S\!_/ʗ:^nM;.+<" y$mzM flV7̋̋:f=yyld66-++̛ͫ@eXl+J[iVMUʰ2l+jjZ[mVnXk5}=~~~~~~~~~~~~^a`hecg`d\\\, n nn n n yCq`(!T-R^?^6"qC/ӽD\Bn@4 )d{={+OLS/S@<(dH?1QT~J (_ѭ hQHC/*0.O4P0t44ʬbV3 jf5m)4L5SYƚZtY۬Mwuͺtaf83̤Yf7llH3a65Dٜ1[hlMm64c~f?b4T,i/Ձ4=R%zrY.aIK҃L+Ί*VeUVBT+..9UǪCszV=z̪oէBRRzjd5yeejA++I**Z`]c]C:Ziuu=e]o]Oi՛[X3k-[Yk5Zí=@I$zޞbOt{:g3ȞeϢl{6s9]h*{=V 텴^d/b*K%{]l:{^KRZooҫv{;mw;5{6{=zӴ)lYz#|y\\IoWWSiKV+%Z5z;F |+|;6m | yBBC6ŇPR(vCA-+4 4>5+5E9☘!fB1_,RFFYlK|,}8+YOd}$Mf_*ʑvy[]>-˕r5_/r$KV]b[<,GqyRi~d'3I4yм`ܖײxVjX,jnXVgeAV}}}Oj%m]}C`QpU$.!)X򇪄BxuNBX!V7V5{^P>(o@P P>(OW'品)@@ a{*= ]}b`wm`w`w]`w=`w>;} P5 z)P5Tm T  z9PP jk@6@իmWUU^ TTTvv^T;t |dhxаF`_O`M^>}}}tttFFtFnF , u7ko&5 u/k2>T4_3_fN6= lؔEsąT41xZ<+V+5~c#B|%Qc/MM.{>(r#"D.Erҵ2C*_oʷOgKV~/.S>3N|#sͪH&;y eE\X+h%Xլ t"jf]n]i]m]kuZ7X7Y7[[D{=͞iϵ @E*bowػgW_|9j!_(J {ŵs, 2=h+*.=1%jTآQD{+bWhwKlQb=.6Ewson˼93;s9sF;>#|T'Q]ࣾ  >;|T0|TQ!QQaQQ"zG  >*>?|T|xQG  5 >j8|Q#FG%G}5 >[QcG5>* >j"|T2|$QSࣦG*Ĭ=gOݟ?V_cGDٓ'@vq,1Kbθ.c2`q0`M.`}?ser| V2VcOT^RhX-iq,N~fLZ8 jI )@)C8 )nG;"gp6B_C#졑P==46'zrkCHG\e7LȌ] y0Zw07[ H(Vrte|vNnna)-=(5=]mMI4ko6r w0k} S%|-RԂ)Z? = >Y9؇YXu! `cx_|S%)\+) Ok߱WK%Hcsfr4Nus>27~Ɋ;;4VUV۫_j!vYvd ϻaM=g~w+8Y8S_owc?CY"ƳiﵮY3OJ ǚS @,‘_l'*~_u%;}fCFɇs!GxÞ5F ]sϖ/Vߞ6d DYj/b@:7鬍-t'Xzowl~!l/d?WZ"qv&{iR,i o .nc\-:h]K 3/6/fލI _?wC0jM5eNTcw'pVYҊjŴ5oVB+JkeZ9U*j4_f*ZU_Ujh5ZZmVWLZC5֚hMfXQt+/aiBs<|Z~VP+Rߪi\S45gE3iYsTMR-VDw_+Jt_Rp Ժ!Pu:\ZToQhu:VW'ID5YNVSij@]Tש,u:_]PwuL]P5*uAMSg՗luPVuKݭWOYWzYTosz\ݬPw{Խ>zX=QO1fgsyzIQ,H}R_olzCCg%LW)>,%jbwRꃧXyv:-nx,-u=Z>ai.{^[Zh Z` XCNU#ֈp fnfMU֔sw֌yܓ{g_Tʺ|!Ŭ;_ʗ`/g=Jj,47 ,oX/oa|;z|'w,{Y_E!?~(?bO'֟fq?$_X/s/ l0/! †kol3@5YjI!'bd67XJkuU}krn9˫R“E~Q$ĊRꟳRηYB%dKa+VW#[^Oֺ{[Zvjmݟ,}a]"H]!RX 4-5ZjahݥSEK]KZ7gh `]+dN܉֙;ܕEj76σl7/K#- v"d^܋l/FͽvKdx)2 n9^lׇNvgYdlݹ|.<>l{=lw_D/!]Ɨ+vWUdku|zlW7d[V|.lwC#vdGtN{#=Ώf LI{"=ϒv忒^vdu67..lGHk PCdyQӑ{Kj 1f'-Lk'ԧZJ"U\kZj_hZ-HkujCjR#~YtDaSmQ{#1Yo=D%Ǩ ӯmʚ Bڶ)Kڜ퓹_H4R#Q#վjƨX:?G7qtk_jZ'E?vΌCT>& +➝Xk>-Ju,K7VDZ|ם8fw͍ic}P4WKr>*pA K, f-ˍOV4q @qqo(v?9;,{MDÚ;_$1Qa]/!ދBYyalk'?գE8'.u&b8E'/F:9lC1+E#,:ER9Y$C E3!.F)T׮"gƲ3PQ9..7"<0bM_5!T\ޓoy)39m3lrCr+B񓩆8Ƭ|>'νl4#lc'9Hކr|6h85yE.Gjͧ[Ű˧scc8*[Y>fV 32y߂۩ŪbnRљH=XX`߶(m{yYMJ1>CjZ}Ԛ=K)hk?Cx>t"{D,(MyҢ|L>ٮ`Uy t:`D7VlSZ!m'*7|vR(:tm`fIl*Kȧ*v19qj\VmE@еZ/y=?)u]ycx<X̧S{" D:"4YL"D"d1TE,T1t!bRb&]A7Wp<tK9HfPK yUAi'SgΦ.]0W]M092ɳZs84Jj # 3ȣz6Ez6!c$4%K\LѤrn]a/ȧǒyv?ra31cta\/L C) KcR;z('>TՖY{{]V_YM*!1%_B ^K( ,*mmrHEKITS(J`(fihc46vN98pĩSxN{9=1;&/_8{887t nTM-]xj)e*R;6Xg09% $$$$I td2d:2d  2dL2MGL#3@fБ 3Af,Y t$$$EGf#sAՑTTTYd,YPG,Y#A,֑% K@R Kud2e:d9rYdY RGVY#AV֑5 k@Z kud:u:#Aփב @6F ud&M:d3fdl UGl٦#Alב ;@vN ;ud.]:d7nd9r@G9#@ґ Aȏ ?#G@ё GAH:H:H 3:r8q9r䄎dddI 'u$$$SG~9r 䔎9 rZG΀9#gA΂Ցs @y u :+ȯ E u%K:r2er䊎\ rUG\#A\ב 7@nM 7u-[:r6mr#1<5<5SYuI*AsIHH#A}7IYvI*AsI'N t3Hg: H +t+HW: H7H =t'HO:# :# : H/Б AzH> }t$$$RG#Q Q Q:  #1 1 1:H?Ց AHHHJLJd;HgL/`I`ַ>b8z7y'VUa;|z ;2Eve7MYJ2s-FְRpsb2!$b"Fe{=t:-{k.CCҸ4nӸl_=t!k*F V1>s=Ur~쵦\ZYb-DwT)b 0®"Ӑuy'ϷEL:bdv:"7lW_C%Gq񜵳ŕIcm9(@ -^OiŠ#]E.0?NMDK]Z;NXDuοcNN. n:~]\Owؖ=S~[_׵?m~\Gx) ͍5rt,_+gtX) $[w]_ꈜgo#rI'vA.9<,Ox>Qq^W<,]f9;l2M;^~V*aCIZ^$z K ϒ HŘWi o@u CZc8ω-X)E{"Z3W1~θ %D%7n].{|ܭқ?òƏm)^ޕ#ٜ`Z\?Cl,N5^3}U?Ý({ŹHrF1܇b!EΔ˛8ħ~Z;!v<,k5ʻ`X.ṱۅL!!c|rY\O9RpΗ5,Les1{GL'So#4b=+ ڏ|ۼ*Q)rOI%8MeBej+s/)Jy oT޲B:C$.R h`w`Ki~~]cҥ_uyfro;.qY"T H UY? ˭v:a = }>W-tLrL ޝd/v_>#T -R#'6bT>G+g{'QyQ($l@x[ ϥTɉH/ lLH=ٚr;GnW(Q?Aш||n(R)rvoaI!A~IdB̓ZWҢf4iAlOVtsQBC{A#}о(h44 KaooAC?HO`rBP71xL.fP+7i'd|tm/sV.3E^y\QmO'RbcM4|U%)cO~dQ衲m?i_vrwH a`#;o]Oi;1>l"bV>YVYDg÷g-e:NI][h~،%h=3d0%[D.9u5&#2|ʩ涬rZ4濞煘m>'+hWhOhohh$/4 O*sϴ?{bjfZ-,,,,,,,,,,^^c A!^rBO\mBTvarLTVΔrjEn;>jebo,MwBjE(c%^hOqb!F$ɥP}1՘Ҩ=J#8E%Uq[<O+^1P (^J +zJ\itP*!Jo%FW*X%YQRjeM٣Tҕ rQU}10fk(d(f(e1XW): ::::J΀΄΂^a1 ]]]] ]] ]]]] ]] ]] ]Mnnnnnnnn== M ==̀fB^     #ՀeM`]_9h7hwh0@Caph/hğhhLbqP):T\M3Wӌi4zY9 z-?PGk8r&?'|d72D;g?C B"maְծ\ؾQDđ86OEqQ)F/n="Ɗc o磿,EM>~rgXt:EM-&SME%Z < KkKEFxQq&/X֟ES.]X;$fȗ1g7~.'$96֨P㑟zՈss}~mWLEs_=7dDN}4޵RY>,7^|]jusӗZ|Q"7qSZT30h]h|ؒCE*ZPR`Dη q}XmۍTni+WijF􊋋]rH߾9ɷgt1}"dl=W_Fyq)W*F2L''g -,Mr[Ol;HHHk;)Y<6Y\sT\~g%߼kډ=Sm[~ֿW ݢQ߶K/:ʻAC_3j /w/w}8ŊX3UrS ,^d,o [O1=̥pش{~։c.,_] NX!NΎ3*HR)ԣd?4_&m\v.[k~Jz7FMH=ŷjxR{;]qE% eC=t;"s*T8`#;? z:OnmT~D3V7\?W7W2= PZEʯՎKqhrt""zDžz+:6"nRKU*ժZj⇯U-}=GW~m2ghv_qhv뒭Te)G'l&37QԵ)],e.>w~0fHw㟪3ɳp[4NE ~(>M2 _/~]=vmn*<5iG˼7x2=l fS7a)[>lG6[zԲ<|NV.2KíKThyE VZqҶomNKi`[S}[dઍ39?u,wJTzoQ/9^}CǙ8r;*k٬~?h:w9To}z.S3(xM7mXwce￷v];@M|Ɍ/x{BA/J ͕zkae';ׯ;V<3U7-#_8!jW[( erցS%. څQ)aAO7v=V! K(jI]C:}Aa)˖o/^rw2^y5ݽ h#g;u1}*ZƱ>5ɘ^Ŗ!5vfjjO6W9{.S2m.TN@FUc{ 4Qsbmk@YF5!2(Bfz7g?[oiK_ұ8Ig]ξ+-X1 WSܕuɁFy,^ºa.A"B ,yW_ٞt߽c, M1=g,9zk|BSoK$.RᰫxC!=H󦆟SfyϽ,o/A) ΉKbTYwO;%C@ɹ`Hjp{t[o'MMKOa;wvیŞ7Ɓ& ?AGFb}\gmn].IU?$\ͧ(2$Tx~n6qѧz)+^rFykTi&&B\/j[EH)Ku9j_-qh/>k󽵉zݹ'9 |V~~ǻafQ$x H_1116~,)X[|+bvf*8Q[GA/(hip;3eJ6?oH-{ۦ!\(kвH>+fd'q2ښ<~@,Sg[<\_NbTv5Omxcһ#^vZ-K+-96~SEʎ5bMB9ʧQlfp#]!ߔwؑD8B#j= iU׌0ɕl#1-iSIUN0K K\tT_Cj8p o;Հdc:??>P!6rGsvWtwKD}%fXƔ, Ӌx$);xf/n[,3}D)/prFVUa endstream endobj 325 0 obj [ 0[ 778] 3[ 250] 17[ 250] 19[ 500 500 500 500 500 500 500] 87[ 278] ] endobj 326 0 obj [ 250 0 0 0 0 0 0 0 0 0 0 0 0 0 250 0 500 500 500 500 500 500 500 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 278] endobj 327 0 obj <> stream x]j0E -E%K >pIjhd8 }gB07{;,|wʎ\4ـGlNh =Am<MĞ., pĠ~yBoGOCϟs[ 0pY\oOOչw(Urي@R^z*[O!JcDe*IeU"*%*&)TxeDy'! RJHJRDKRHQ4D:n(JQgqkȗ|RE2n8 j*R,~Th Wp-' ? ?; endstream endobj 328 0 obj <> stream x}oeWuߺ{lo\_=Ëfv\.Db7E(2!$VJDj|DhjQh!E*)H4R~hFJ=g[uJ_ڹs=k 1y;[WWD.c"[zo;=>O+Z]Kw=yo~>zXտu_ק{CO^MOgD~a}G~>'< $'CW@O}Oߪ}^}ǯ{ o#+]}꯭}A߹;+Y[?Iy8''3OzLT3Я_W2w>p9%х3~z\_H1z̞{3z v?Y8_=Hz\Wl=7;ɎxX;(;k~B=>i}eqc.s=6 7xX]Sho6y{=. }b=}묮gމ.[{{vvL`G?k)+?5u{=NE?ΑE;of<`q}Ͼzg{v%uee=NX粗L 8oߗ #g 8߻=혯y<߽v_~Nnl+m}z&V?K9{bS{wWGb*LoiRy̦q(3l<\5O_z3_WүԵ`KkR=Tϵ~֍>-%6{}ʇa~lg햟x-[ڝ/7ϟ~vwۧ9[GvS^hSVzz<[)gW*6-uk=Jtm}j#~{z}Kq~{ |nuZY׿S}ޝGq]RO{\3F53 Jj֫+t|Шto9c jVGOj~}Zjζ91s9ֳ{s_v}͕껧gr2n-j/ҧߓAQj{+ķ~9K]nǝ Vmzv{-wjŬk+T2Z+ɦcG'׳yvK=vojRoŽԮSi~E+K6tƛ֛3c`4:kX-mJ)Wz8\^ahlڳMZw^|biWlsM:+YZJ1 S7ػʕVՠVr!0[kݵ'A[\-dn9oWd)g)םPu&!p'Rٟ/{ N9~2Ξ.{0<FeyQ, A(ڞ3bZ~m}"wˢK1x? (N7ԟvG$)?J>GY,ׇ\T\&/jM!&Ӣ%RrJ-\"/!?ڥ'K-}:$@rpz݃AOڝmS[~cq){y^ki}Z>S939wz4͹7 vl\LFvջ(4yhxIc1xY9PguPUߓ0X+LvV0Z"ʁt6BCE JA{zTrtF<퓃vO=̅Gh{F~rs%(nm&sA06%7Qj\aоLyn8 9Οjns0{ c9y4yߴ߾)ߍٶAOgvO5b34,f~pz^J}i}msԼ'?R4yFY4(+MGPY}4z<JEs7RCO$g6cE uNlg@ ڳi;im^iS۱m積hݟJή7FAn̮(OV~l\׭LP.Uri(T1Z9z^ۛ3b3k{e8X;^G!l׎u]͡$1Ow̽c6%1:՞[-Sؤdo66ܛڬÓamU({2N^|߽DcQѨs4: /ce ;\ c4 8u4z]_6aqc& mNF9޵92Z3>dMؗmo %6 6΄Lq!g֞y4]-OUMqT1hT:,##- jуM7#~$onzg o|jo0ϟ];x/{I&RЂCv19VH=>fK/tv-ehMsКˮ?1[\BD5 ƴotbzA|MB_`Kc xU1ULU7^vbQ{o5E`Sb ,mhJzTU/K2BF{ C2]FDɱT݌!|= U^yB^g]m%јv2]L^'PaǴ|J<a P%cZv;΍||įbGQF>k2 C31~=:S@O% O:#'W{ %L\XF8WJ콾=Q[p`X.x {8{;8 `#sDsAp}Dt璗R F}v(R}l7q-:Zk0$,\Cׁ~y\((7^b0靍bᦆESƎxEo4~%SZdW hh"crIdv7C_(,(uQ+RhtpWmV=pFiʄUt$džIdOYVJiX`ڎ4LM)R՝=:4x7l5E?A6ml IB˧we 0*X>` 7Faw}Zo,F XڹjvqɩQh:Ę֙_}r3Z[{kowX⣇R:;kqw807Y&QGmk]\Vv`j6F76sgܞ^n]? ?ɞ_ud6+6nՊ\TGԶllӻ< ʂ ri:{;ho!^,3vX + Cpt]o1R2.?Å8=NaSâCma2BQ~>k;*&9Ir4;gfaUeqݛ 7NgR2aǏr)hHgAsz hu\s#wrDx[M6g$ޭMʆsNƇk] /AYJx7퇹 Qg|Qhz׻z؊_Qg\g6iq(ߓf),}ޡ$$,6#}h CN[$C#;}{-$!j j2sx`k۴; 3cGSZY,MTѪJ&l2Ʃi9/9%=D态d<*}p& F1' j$/`!NWI zѨH`i)iFwF9)Nrlz 黈<3po*eQB}iB)݅3OC)*_1Ұ'ekl5f%dA 1&=]x[Hc&x#<>@9E腁O+H?2A N/BhQTK'~+z{%]HK%ϑ.As/w&>!On`A)"{`CsA fvWptE]cq'Gshc-E8b],gwW"bCp$x1Ҩ `b\4oL@ZE#{bH^8DLf;<{˪Azg{?!EaGGEy^(&]>yX?ifVZfU'm^g1'`iނP05^/: +O81n֨VA v1k?$Y{#+ay 7uZ0#ueU!eahzX[>d!d>0$_ Ȇ}N$H>2#s}t Vf hC KDA1ôfOJ'R7 xڐčm|d/lss2 !,u摼EH⽢ŖB[NώϨW; DD=O{K+'FS)GY޴kњ-EH^RVa`E`./ OBҼXjP24($fuqbvhA?p|ᝠ Qs E? y";f]wiWg& _SicDžF놞%˴77 YI){K^0[5`eYR2mP`%3s"?-xx)[LjBDuu1fEx9f"}62ZV> O+ޱ7 ]%|\NjtWqdv!*"'v'?'/ˎ:LcPS1(X]UA[`4ZYOc^9TY-Zm_ ҭ2D1cW) Ko_xT~>TC\^h|6\hO`nQI~E4r():HTCZ$~AUG<80l_rzN?/pMS:V\@\1gjb,@GA&f\ 9c/wVɌ:1J^w`"ތYU:'R#Fe DqH]2lD0Q`Ty-!1 9 IU($Pdë R0`Ct0b%;DJPN,XHpOnco1eDTCgg5 mph -Z6Q)V Gc08:^鋎=t5hz腱JJ4`jmXǖJ(GW0Bo!)6R%g0c$G|r&Zk6,f"`}E\\ɂ%txZv>,5O1Aׄ dwt4z2Jgp#CxQ4#Bs듃d?C<vn':ԣsj.Y8BPh7P_+ًQuh3eۦLE.&k4 ab#:h!n 9Cs}AˍgU^ CY*mGAX'ȽMh)Hpbxqs:&Rh- ֊Gm()='9WM#0s']o;fM >sH:{Cth:la5P.u@`_eӃ ,ѥbp Fo20; k-__Otާm@imUnoG +kV Rzo_Wxm5ȁքuyR~s4̲4Y3b`[o}xӠn`8jF_ePYO!hG2V:j$EqD'o6/z\jVlN0H,4uSFՂQ/Tc:HusCguҋjIԪYKqONgcY^,=]Uf~N^\]l3+黌) gk_\gA4W|{Fm/:.bTwiH\sba6 s= Ug.^cTG~:qALX{=`OoJ̈́xF`lft@|ulNgk2Ղ<ē¬?Z_AVMBwc1 {I713}Y>J4JhWrx%;hZfl1Z>Boj9'1cXY qItS\3s\yUBJ]ۭi(`UƾS#vsAFB\1~ی'XKk&#ΟJ'|.A@{K$1YC̆lFۥe斚ݏ%FUe[FA Z{.l,sw{Bldm;;p> q Ƀ Vb1k7y {6 v{)avϗ5/Igqr켘s^_;1ZنHqH=&ʜ58ZZŜHE7s 5K}=ߥ"g:@̍$dfx'" y'aV|,RD213,;1hX]fbA d)TsrH -h&|Yz_Z؃IJ'u8֞X[lZ*Hs}FT)PqxU: H3BXED4 z #x)ЎANGg`]?= T^qE7Dc~^'ء: "rV$ mxE =؈c ɘ#b N?gN8}hdxz5o+Uۃ܎fjx߈՞D쌭`7r$!ߋYoZ޵ٹyGdgfr2oĺ0`a#ԓ$!jYa3!4Ѻr$j *ZFGt/D"i Z`{ cW@$_Xc?:6B[L6Шn  lFzPE`L6%cૈgܹ~k >8 8@rl.Чs^PBވ^aj1{>tF(>cX (@--|n^3â *BLjQ䀍;bQַX.GPos҃nK}NhGx>z(Kd'gPP|EH'Y}/W}}I5(kA"7mAPY 94r?$BъVμtHr:vzڴMp$@/P8>% -@ZԬ`߱qpڍ<5uxGiن Q2f;moGaDN (s -*3jIQ_̶lF*EFwdVF L֠c%?i+_JF;MedekhV"$si̗$̈a֣=wgȏè ީZLٚK[y;_GbrM :Xô-, +U,浫K2QD׾WmVnekQFI )% iZORU*$}6}.99qNEPgz%5XR5iƶ@?ý6gi^X`2RaWD&J 5b}pp{z,DS!?JA86K&@ DOɳ5h/-bzz boMpjJg\3Y$ ׇp3 ;,'~oKa9geC~ф[hR= vj}z;Gv~$%+ƣY@SYbl8P}{|c`e; uQ6Dj(VBD{&K\}+?I8mT=5 +6¼\ 4;c$wQm|Xn-zzP.љ79W-!OZ>|3s ~~3Wi:uM#M~8/SDG\@[AboRKskH%%g"ΈA/=:a,,FTL/L uԽqU7sA<;3#.#zDd_jrz8/Zt%ic7 @)sGOy ;?cݎnwd}QښuFWȸ81!HJIL]c OzYJQj"_# TΏN8 ~%MSj< 7-ꤔKJ@ңg;vEb~q vRcfjhO1ti]ZV-)=3m77Ͱb,n윓qo& mD_.\A ;^;s'ւ]7AJw0'l$̧~ "ԮLl=`RhI jfЦھ,8Ðrů 1u@9urRAcv"&WoQr-fS A(s4دSr2rC\QG -{_<rwvJ%n]vDlA!qJCZKU$%,[P%V"BsY*78m]}Q-N^H/ԣ:vt78蠴 abG:XcIIp?w weh+9úg}ŠhcyH e Q;`wn5yAlAq]+E5m1$d-}4dyD-Z[v$Cff"2kk~*& k;.k7mEN%|_5}ݩ:7 }k% c`#ٲM t)1u 4}a1׋v5 xp'}qq<~9pq=}t"o<;uཌs5a?sD-Z0=Ģ!w~whPۋRYJ9ʢ_@5žv4Bjٵg}>^q"FK-88;PpeJcf&aǘ1O%:~{'h0_/;8ϯ&w eD!F WeRܿ+ !d䟴e2Z@(J=ZXZ/5Oa|:S)ZD:Wafy8-ւu$~ǻq|Q675u]U9 mJZ9HXmosr@@/Mͭ4앍sF$i*V%#֡31`VHIJOŭS-K1 1' 3 b~22xE wx;2DM\wsL%lP{0j" W\x!U7S:r!E\iZ(_D]!J҅+AgiQǚcP(Y'bLsa5a$@z"M4A;Ms0߃e cyr<%^$j&t?71@'iy1|+z݇t{8[6j=܍9MĖJ 홣@<9gԏ"HqZWiՒ1p%o|E _ K~q<ܒFmx= DŽg̍!ПQbhQT N:^F ^7h~mjn06PB)39Ü>D 'V Z3 ֈY ۓ$hB Kl.꓈,jUb8(TG)6(r;>*h Q^GwU $_;_Q?l3zv/C|}οs=goqgϮ`Ikk;.{ͷ n{k[]Wi776~I~k6MWE^ڠلۦQPNSXԴ) o.A l#KH^Թw%@15쎡}bV1K91~ xwҰ8_R{wM.QǯҪP홹nl7~,`/G]pO!p4 ;_$ᎺxÏcR mg4a44r[`%3m<v;"yD*0Ch%]P7)H;1ZaX[5+`&Zy{4A9io|`rgAh6pLmdL/}F,3*Ð AK׸p&Ji1δP1̊lj\5p2ZK##H$FρWВg_?-fVctϥ7@I昅3o%˒W,W10-Fa/k ;.|"|&T3.k/Zhy&9FfXx#n-b1>oA+^a+29łЋ/>'prx 蛈m:d^(9Լ 8RPs.ϖynQ?ݺΈ%~biX1< , Fؗ~#R5WFUDD>ePܭ;ZѧB =e[}mp$`?h0q"~]Ut2,F$ gKI`yOM͸ h sM.z#gcD,6d~cz#Zz)ւIni1^z|Es%)D0rhCmCj'N>]AGg\q5áN%:ѲY`MBj& ք@_ Y9[M>48 lPÈ1%lͨX7< Eܥ99-6LP_ld "X 'IrO)4?ձ$r 7Pù |~b|dXp+JMƉwR//Puk-go ŽV6.kBffwOLy||O-W{}8;G;8jԓ`_p,}ȉAL+,jp01X찝 3 ~Qڮ~1gEkM QڱC{ / Kl)qzE{RlE OMn0n^&ֳr]?w֏~?']=y^- y+OϦ]QhmKΝrX7r+{o> kkkZR=U6Va"ՕQۛ gmFhW`;? 﫥/wޝϏ{S|_kܳW֒W~t;ؘ}7__[oujyVLi{Xv==o9z`_y. +~U~cϫ;p=/_|cS/W̗W]Y}?O>WS3߿okDOY|^ښnQ'A_+gr:s. W.?Tgd}Im]oAfn:wrg}qf^t˯ {tk{N|~Z?<>5~b؍7_]xcǎ{C_Crwr oM|W"/ߘKHUǟ8Q;qG YN_ݤ;NH>qߚ^ K/\zCwܽ6nXo#޽zmǮRz}s9uX:^V ]I&?&Vϟpn:㇯>w؍N?w3>/ߞ?g_W>_Ѫ_ЀiCu0 BLOOPt6 iXf! J7Q[)x" لp#ń^mAXM6SMʚʺ(wLFdwaR)}6Wꢢ~"bbNܖGD>D)LPiKywCIɾb!swuOCLYW1yHڕY[-|5D@L3"`B}9Hdƺ]&.m`"~ 0M|K"wq֛t5ӴU (p `Q0ۇ/xn1 SyațCbv AӞS,Jy0bhtZ̈tA\2$?p I=ar@L>=R"Z _d4/gb#>m¸zp`^J% bXND)t@ YK )`YA<Qjg!TY͂f2BykL[jH:n >FLFop8F?#(G ㅆ[#:y@ Rdҍ axʆ( S*tB2IJD9G%@(ނ)"nBT } 9Gɤ(. qL]Fg?':)8|CE0gךcq,8}O``c׮WC ؝)y4iZ sbPDQtJ(CR6R!3#؂m i-((QS#FWќJO탐s0Nò:D F 9XUP<^`R0k~zB. Vqԁ(ɥ2 R]!vAVYB$"ÄN ~A,ZYj,T $#Q}eIIq)))Tk#qQ83i/Qq-@o~H5rHRؓ Яc O,BX6))EPe*RR3MTJ@P,lY Vˎ{ Q.T { @AF ^6ywDGbpc v`a(&#JHhF5D#%'C' (hиhFjO@LgCX2:bnX-b4$1rAp8V*Ѐ(Zd tRA(ݦ& RJ+7,MDZ_XLv<6YaJ! SBe%xj)`BF IeR!#BZ6dDjEN!Jni!^Uf b2y!Ǖ 4R 2#V[# ^xs|sl^Ӗc  eWOa% 0AhF* rAΟN頎h~FzHyGa1Qgb 8\q M ` r^+?[B[ŭ*AM*A{bP . )3%z40 LB. Qr2*\%6 FN~+KQBͥ3B3h9X^/d Ȩ*) fǁ\jT EK,Aru<ߞ+{P%3ԩg^+L@ hoShkZY@FEX1J@AzX֡PBP<;58RiCTMSH32j%UKE\0?Hh?hV9X  lF(.FC'WaݠN&' _?q1 *0|߂`J s`0 `0 `0̿'`0 q@? `0 q`0">`0 `0_`0#`0KNa0 `0 `0 `0̟#`0 O0 `0.-1 %Y`0 `0  i$H& 9mQ~Q[LpD4M +\E.I9$!%*m mQ~Q[LmQ&>, M4l7ڢFtvpv?]]Aᘢ%%93EDX{="#?%gaE=s u!)(#;gxFP]r&vD mQH!kH6cO5׋TY_o?c?W ~+ru%"g7RB-*WGA"Iq ~ Z0$MS$(7,іj(;D&SѲגfV?/lQ3)Y&m{k+Rޭa$ )[`j24y*Lz ץ(.%唌*(j潄\=Nu 1A~ϯV1lI#hd^V.d͎[$%;)mvdF^|vLf[xn @2'ńl m8;>eHf}f^zqyh\^ޜԅ;zާϖ]z-]Vq95hxG2Jt%%őZ5*d$\\ d oUT! 7"O?=_Nm;*klƤ[DY>-ߔn]6gLPDܚx$p3(a(yʍ{kkd7-7ّ=Y;;:嵩U vmw4vwjL".T׮[R齹3W|'$mU;q|,5"c=-5؜qO'\1u͖6?U\ZV?h7GN8(dCY5pG:y++cr_kߥ[|߁J^ٴ[.A %mWw4]iiY5_eXb dAP E=K2JF._Op: /u`EY= g7HiҜx˻ 4-]/-kwݮcuYmfVbES ٌ hWc{7vǐUW[`V`ش=FF׮ٹWUo3;K|.׵EC@C{߉w8 뇋|ϫ"r u**(.TNQaIk'{x(J%S31TϏ @vDInAQ^gj2x>fd59w+']Em{|7?USxtvO/E%Cefso}X\8aІ=CfƝqcNΖ5=۔n{(6'xU@:wyy2֔_<ěs7fMcb Oo,tqBI?WݝE}sbgZ o!uVuUc$UЌ5m`^.rITW/ziʲQ;>.t7NWFTo`&ߠ9IWe%tsMorGb;ݳ^)kۙ%uSn^?љ\zʗZc%W~}tڛFQ~{l(<++G]8:$ǭ\j+_6goOj++j27%OJpXSR{bwf?;ʐxR4/4ga<f /_,w]lD̿F߹ٿ,VRS61GTtlȒfnKLG'cCwvrôwt`g7ONLqol[mM>p]17ظWK{}7jil 6iyP6#)͇Oub6c}۽:ڤ4sq+? |yĴws%9:O-fnzml9sT;cИ:j|qNQG8QƤU{~'QF (|?w,$^ ǔ讻ՉE~FI)|*]/;KFgaMv|[>fQE+"Ka!ßǾ*'*,*URJp[SBsfOϻ6oJ+% 4*mwylBj\x8fhrM:) WTUw$I?aNTwѾ 3Wu R%m\nN'ԥG1c%e'sO3q#ਟw>Z־&zS…_%_xEhșI"_' ԩ}kbF|XmÅINTn#ɿȧ]>NL|ER-$NDW7L!D*ЁWxM^X݄EC.SX0(0w̯KB$^Kyق'[G=*j2WGqrIn[Va,TCzyybϣO;\v͘mGSn="'?d"JSsd@fѨ}G*'ωuMn.~?ûp^ZԮē#TD{hOLzʼncatpW\l@nǯcxb^+1ڜ뺌2/_yyȭ29Lޙk»ym?|\~-T"_N%< c*"+no(_Eͫv` G&w!Pd3BV?vo<%46;rϛo\xȖwb돞7YYp+{ߒo=6j9m[kWZ[>կfĄ 2h_z6^߈w/O9|.էVe?>j idᾁ_8lvN+"lk1aM~M}l1gWK O.KgN+n8R]-޷dkPfޖ cZNf #|gw2eJ4c̼8 endstream endobj 329 0 obj [ 0[ 1000] 3[ 500] ] endobj 330 0 obj [ 500] endobj 331 0 obj <> stream x]_k0w?Eb6(B?z%&(p%wa%t p|nQyqSو%\œ> stream x |TL&dL!0@$$ P6f@1"VBު v__'6m_iK[mkڽ.R֕?΀w֙}}={s]rg>CDFhpȭ66wLj{xӗsxeg̞q/xX$뺅˗͛]G">iR*nn>}YM]c\˭o\rKWlطfc _6B׆g$6q]ߚ$#vvf?9_gB_,2+7n?|Wl"ׯmkN)m?}V|/]辷[{r̔E~ִ-}$ mإɗ:c_AÎh;yr8i86:/9z?F. MJ;%2=9P :e.㒌KScͥ7t0zQYj(% $ v;a]Ng$,Kk_&c `WãT|a-o"⒬ɒȻ-;cEj̕|yјoEh,R(EXcDޒ)X*ˬX.#4 22x8R*5Vʨ2JFk->>kK@JX+VxdBu/i 5gʼn2)TdxhR#kNKdzqL8MN8]fD^d̴>'ɑWƓ4,Aq4i#s#F9Uc<~'B ,E^rEDiV<]F.e%\Rye_rix4ߊ%+"Y1$gi\!49Sxi\eųeMEibk\-4s"/HqlиΊy?z9_㹲Q@y9oōr "ȟd\B+^$iX.<'/4^Y"hB>J٪*'W˵i?VN6+^+5~Њg:CF;#rE rkrܦ&ƛCrgr|\G.|BIÊwʧ4~\>.L7 lI٩n+~J>|Z>3|QN{?'_y+~A|QyZd/75~E<%_ƯIƯ[+|SvkoOư|+tZqti-x~e.y(,L4DSyBOQ+\~+ɯ#N~ 'w?DKyFd_k|X~#jH 77+^lmz,]:M{lܩHܸ`P13c}r_ϥ5կL1L|0 ?ޫ`H*>H ??;(~uvR/H? ImB@f;NEr]Nзz.M~fdI@^ v@RAv@O2w_=IuGS{mdu ]ʓ҈'y_ T?C'e@H@lFez=@)OuGJmB@f;NEr]NWзz.M~fdI@^ v@RAv@^o]r|JX xSRPo>S޸`P13c} }aH&>0h$d$PYY,,]F#Wu+=)`LuGJmB@f;NErT]NWзz.M~fdI@^ v@RAv@>_i{[zJ' T'p$1޶OV__ 0|N ڟ/ao@3R1Ku0KuKuKu/{{[}KrNHM{lܩH 0>zsirM0d$LjvxG.==hln^|,~RRPo>SUq7bgU%,Kk_&c `WãT|ĉpBna7:.~[眀401 ) v;11bTt X }aH&>0h$d$0yOyW󍎏_]٭ԋT'p&۽dCT$下`P13c}&',Kk_&c `WãT|@]]@2uSįu+9' ԥ:#6} r"9.oAH'@KX[=&T3M@2$xaG; ; 1{lшͳEBqZ!>]*1H"*;O;%/L+F\ k{sݗ8_gkM[n;PDB>ny.wۿ{uO_rOן&r-ogk>s 9cEUш~!/6J~蔩ӢTS{lZEEvglCGcȒ󣓣KdgSC$Tq#S"+E'S_NN]v{tȺ7Ӊ/l;:"r3:^Rf\xt1rVt(r=)zH)"7SDn-:e9P6}LdEt_^rEhE ̟w9O :} '8s ӧMR[3I0~\oʑފe%E\wNv+ә d4mv_}+jR |5ca)j/nPY}d*ϫ~xvT-CCMbN ۪|]ÞZFkeq9uE2Ҹ%<`1:t{H411,ŝ~.,%fWfHX5.YIM(~5lEr]g 7mo}oL_XRPVᇗtd YbUHgvN}a-M'vĕWhdNZu!Шk[sD7;T]&v gF_=7vyduk=vfKަ :^մ~yxdZҩu<ݍV0OiCfVFwo_ռL@˚Ӳݿ.yS:r|kh*?g;:;5ͨAнigMfi o[!zxwxzvֆlo`<̦ Zzuhz64^rni}낽mjsÎ&3Ŷv>x/VϜpp59=CXfP=4Y=craY.=Oj^赎>lܼPQm:j{cԼ,м$z?ZGo`ۡ3Mc^->ss[;:|s;Z;ں"V|@Gݱgoxuqdz9\dyzַE^A`ʼnV37K[H^\ҥOo3üM53Z>Xc]Vcv5{eҫ1vϽ%Z7Z mKZe`MVs͞kJ0l;=W?sGA7q޳\a׌.bbK6\ʮWC}JvxaOu8cNoC)ǛmUw>E KGliO@m_P0g#-kK^łP8|^ӧޭK_oyþF1^h>4e7vYkmkW6¯1^ppoֺ[Fi7voJF`;˻Z7Ѝ%<`?ËX=j}:\-a3fwK:Ǝe+Z=Ncy.a:;9V׷'6cYɱbbc:ޘ^h6>vNNlcگ3ZF5o7X5jkhm'9?;6_4Z_Ww|VmnU_V]qQ]tC:yO()^R2pjI~}$kJ^S"Kƍϛ0>buޤ1Q|=3;2b^2<"S[(έ&6Lh0aLaT!!`oˍpa4/.2tlv[ng-^i76lۡc^iʖ.czbnnPuue|n ̅[+C;nI]}(wNx ljx}KLxˑ՝YA-^:9_+-G Y|XMDk+4i}]V@YGHucl(7;JB֣:WXFsܮݦޭGE={>yPWaX_D 5`=筑gmBgzT!:G gά<:ӳwL#`(-)Ҳ')Ml##S 26uIoy5L^xKc̛ұXyɹVgc;_3hcH DO]8TXdʿDNfŮb6mÖmi p‚Ӧ-&džS67OL>i ̻gLdt/_t@0ȴ*Gduk1bغ5=v{Jq~q₢.]J}erVpU%E6C;h[/ηv2=v[WdϷFwCo҆ΐCJf>{Y[Wꏎet$jf/0s]}uMDGwZQ_mvg30jxG"CkKit o3:c\V<ܥF흆͛3~twK|{yΧ̳97 7_P:r3/J'Ƶ\GnÕS9~"UƊck=]ƪ }d&+d9es^τ.`IJFWtwQOYY>Jo-}t_m/0ϚmͿW04oTq1;5*+e<#Thwzަ,5X,,1 *X@p¡RZ#ܨhKH?0\7hӾ+s->pI-6>O:0 ? -78Zvo{<eeq*˝ PKbE'ͭs^!QycJc1/ j2P-8Stg:AofٺGS675~Çnt*,RyX)Jt#hpD2*A_p *ce0BM$YC/I*Uj 9iN%LBC`aUN9JlFtj^۴󞝏HCiYt+*aN /obYgɒ`4hkg/gc9<EtE\@AM bDsm6cWF-|4*mI_jDhL!O( !$}-%>PHATR6] ZrE!$!'rv`ل J1LŕY6Ϝ=؜L0OQe;CH<&Ϻ.c36Wb 6W].p=(FYBJgܟkB4 ` JUN#ȫl~b|\ۉʁpQw-ٻKO_ >@+Rv޲9K7w`vqmvDu">0 +Qmt`r駻HzϮ*#(W{m>r}zS>IߝyMw}p/q o֗^K?TOG/}7*qtE?ܧL&'1X-U lCIq^Pi0D!x?U5 DQ 6RG}>rAz,kP Gڢ:{gn0nèh]B%#S'+#+Qq]T\بq;g*#[4=Cvbv ^PUN, x|6<0DYG34e /'䰟}.Y9ڃ@- h7^l`q\,(o[Qb .>SJ5C*Wk>ݹi|Ң׌lڼiz|z;{JWJo~ Yy&DG{ ??qd<hsU*ϣ&gE]m ^Ku& tqS)XsZ0N$N47YnA&6fe#):좹Φ,;s-( ۴BGA4RJ镣QWEQT_ϩ:gZڡfNb-roϵxsfܤ3#9a-H.쓾v3b| C%/' vߒ?;II3Dyݐ(2X $z-}L&Ru:h裂WNbڕRMTk\C+t#0rVt"h =[Dž\^ T13w]7h ΤJT5uLWF>jXHHj]')I>x=ySSRt}j[tŻO4\KqQ%2i=Z^-AZQ;ݦ^Z$(!v;7$ Qn deWJ4bb -$I9X0ug%kEYL2\g< 8Mep9 )0W}d7(,Iq] pDȒK;_*}JNړvlc9E? R3R?b;9KI0 Ɋ11I?Vz9\6{j;K؁KakO@UvѦ\BJg< :у!V)ݼi LZmv]0J_!jDb1B!y ?8"r~7 ;S[ܮ3Ũ%`lnr.QOM:%9{cZf!]WoU\P+ LH9ˣ76N9XE/H+qg 9rl02i.jya[Xe`(1[{~-?VH;fQKM]AP5$JCq,=R:#NJ'g0~%Gȏz )Y:NZҬȋQe߉jY|4N[b1w*t &E9(jkm #lqMM\6qbkkkMM&bMMv"\Jqe mV]єY!:̴eԣ͡ fc "Nm: 4LN.n2gSsp+'DyꥬmLs5U` 4"(yODd8l¥ sX<[(MIW4鱎BB:] @UُX(ǎM' Aydr龲3rb%O5ElTݲ}]:SPHXj52Ǵy )2u!E\8;#ɧ,酡m|bS~rp^:w_5KϮCkV`'ÏF^?~m>Ezl8v^y{ }[:;Ƕm+ͫ ٤kgGPW_ŽO5:D{ tֶP,twgAYLB>ߍn ,84i99U ;9#9Dce ϰ&SIzpet''J Nyl|wOg IBltwގb xĀmj2/~I>7Gb&Ě:XE"Ž@?+;ULX56>zE{{&e1gzHjŸvvy'ZU?r}q1m_W=Z"3Rx ( U#R|4ʨd\c ,^ Mh%$+ JC&*,!ur࿜ dfPm(ÌEdԤrReZ R\}_aßjE۵zq>tLo9QzxY&?,c<.]㥇8EmǍ{;ηi=/bP!ƍdyD萎Jfo/Om˧{;vQT'z ^PckCP;YGLuXOu " %R l En-J)R25eی J-%QrM,Xp+Q}'۹/Ni\;G$d*4}c47z'뚱9pS[c$e;2Q7+٦7sMcOsVO}IBv-ZzO<2=-5k \Yz#JKE)Av7HR [K^V$<XkP` 64,?R(vD!G{&5 ın3wB~?Ί׉Z4E$5ɲ Rc\4{3Vbj= B~(ٰ{ T}04DUGsj&^V{&q5V2@Ft3רL耱4a\sXFgJx9*Z2KΔZ 3~SJVˤCCEKqڦ?"Oч>+ŁמOk]ąKJM)i~mOm;~|=Yz'G>|`]}K%R!0)B8<8<"ٙ&vtsln#\[W9L.grhxn /,g6t*Ng#v {Yͤ7-mkD %`ۻ-&d6vIh2x qe;بxP-`I!4¬ }@ϤO-d6f=~w3W읭;;-9لf^?tzJ@#ApJM_  4\ E[:x~⑹!UP=E:"bn"1Wa_4!\ɸҍQwk=ؽ{{[d+\q |n$nq3^`13S娽bv|XfLn7Yڰ!=ӪTbwU6ӃtTQζ姐XBn*0Frf0/|">J (y@ڧOy~S`췎ɍݒi"rC1EԀ+%7s;,rcҜ?>{{ǥKvj;w|Uտorx黻K]ctE^V*QزdiJ_bGot29vՁ/y̻By+zلSM륥OTo* ؅b4bS*Kt_0Tu fh>N;}pw(UQn [x V%_rQԝ+BȩX, "jԄykz |6qGXϴUXHag;N;bQS\&s؞4GyS;ñfodvHqklzC[~@rklE{uęzA&AF]@zLs u3q븭uNaqNibggCVg}=ESƓ! ٓ99Q3+3$Cz^?_lBvZv&9tV5Ϋ1RVj:> WK> Mƛ4%\ 7*)p?rg0Zi$? aLM%YGBNCffvr(-nT sJojB7ڈ Ơhr! ]U2OHbYzsƵ$=}|V՟O؈H-/2:c-| 7^%ittċ?ͥU¶gwl[2{]+vLܲrvЊCguux}?7@:$۹# 4})4^3"j ^O{44m,%i+h3KF/0I1m'ssz͆l,  -pSzf8({A{'dYw 2DQgV ;lg)v5h6Z>K%N+<44yj`4Q~;w:99is>XƏva ះa)4S0Ea>L=Yr=uYw3{g{,췳?mYeV' Y)`B'y G?0&68`'D gʆ eދw[(Q0y=޸2W ^r+&RcPnW\uʭ=Jv+)R+Jnнi-i07r 6P6t+.y~& VH4+J{G79,>Xn #KcW_۫hve|]S>ǎ%W {2/?fNnۭeUVPAV9ļ[6buZ/-]{k-RZT/Wai  )[XiHWOdW]?ђL:r7SΑk7? ]Gd`0[Ӹڕ8k]+VWZ|׊w]SZE}g4$S6ڒMXspZvh˶["?*v߲VdQG- M{ׅj}B}Enap˿bkVUjU7١FRq.5.i kfjiVj_5Vjm /i+3~j]eYUjUZժVUjUZժVUjUZժVUjUZժVUjUZժVUjUZժVUjUZժVUjUZժVUAr\ofd#;B60 L}CLaY&جFRK,YȲnkE-J,ޖNSΥ|*㸌1ؖ}p`arw$Ȑ3 NH>۳#&uyz3 2U7 2 2 2 2 2 ( 2 2 2Ն2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 MdAdAdAs9\en+ݵur+ ,ᘾ 5I_ޗLd:a [ױtUrCλչo[EK+s+~h˝үqs2+]6X :_OknlEZ~k8jV|ҫF+se߼~MrӫWKzuL#=r'N4]#aMK|s_,1}W+tέrKtz+.ʧ=<#3WRaKtHt+pWx^nsVv{ܝx̽mw]!7w{6'ݶ‰§ ƒw~nBnFm߽}} rnAj7nnDnvnG}oc ֕R<`̷<Ƕ&OͶ_jL49ۂkJ,~yRCD+cm7V)lKNe\H$iSkݕ;ÿ7U?ћx7biw7$\7VJ~pk Om_۴ƫv^UsS{;c})b[#}'`Nػx%J[=(%WZ9JkZi?19DɏwN!^]Xn/Nn7Yy [yJme)=|H3yt9_lm#4W'Tii//-䙏K7xTJ߄: Qja/m]rz8IY:ŕ|\eO׹nC8ۨoRquVskhRۑM~>c+zzd[i]eKb )8}sZ/4_bWPƯxNJ](3ADIJ[ȅO&2or|{vv\K<:O}e@u׻9X 5.,s?O߽{?3`/ҿݏ 5l>I,[E}+H=u^IK"zF?ð>{]QEzܟ}JC{5 ¦|g 'Ost>ʿ ba0Z޻~X{1cO[ݻ5^}^=){P.>~JKt?jݾ\zoܽ._Oc\Ew\2s?rtgkweD)J< ,u߹`¨ϤD;b*O0ޝ&}}3(ˣ\c.>*|OMSxk2ݟ*$jx+i-s_{[Ib H} z}trwVk=d^tE _~3ŧ8˜Mgsuo~V^{YRk1gsGWܟ>2V޼}="i\J~WRBswG lC>BkΥS౿͟-xMrxeK叻rn݊^YgPI-Y8|wH'󿗿ACWV98s–T'r3svg UD޼/wcGgz9V:p9s!p ~{U{olݹs;qٯԹ^zﶺ+ TԺp_wA[kܿ(l9B2^^vin4ܖ̽{]igWrC~})2 ?q^˞#_M o_7={|{y=Ů +#oPsx>{,`)?x8{/*T|OO3<]&/? OCv~$}9?V7OO@~':ֹȯu jnr$n*x@Ni Xdݍx_G[<<~ OCFnkB2Se:|*ʌa@F16^*OʳH`FB /Dԕq Gm"%rmK~3!-(qZDTQ:Jp`fQz%c%v0}Raֹg?nޝt!N=+5yx)A'RcxLcZ5_Y:L$?D`BJᝇ7ew%x1HŨ'mDm㓫#Aц; ~%\C/}5*C=Uwp9`GpE3 d!e#ԜF>Rk±;Fiw*hn}HqA]QuxޏC6 E!008[Pg.HE:cd;Π>֙gjW:p0Dک7A͵衅fWWՄ e\TXR(9, qo?*P@15˄+<'|Sk"UKО}+;yk .1K8L>-V iYeI\BE"*Bc#QUL-`}f: i oXU j()mQ)&i̧jr 9#PNf,c*e`dBLJ{r۫V-B\s \1 (i"Y@9>0+!T0C.##ԁu"B.(]V,Zkw*Gce< K, amJ6ǐ>D`tuRj֪:-oQ- /ցaJHeumDv8zApeIGpx(䍐}VH(Z䈐Wn'~7FY\SsF*oc//?BhOVګ#<1QaW'uSLZV`F5ƨjl [UhP.&k rqlƔr>EF9&i'ˊ>Ei'0U i3SvMC')ybr]k1^ɑ5(<52Ju9 ]%JBfҤP^OEjO Cni6m08KC ui&74I>ȕC;U̽HN}=tpe)O'E -''z="eEO}7}h zU.h%%2J-)99F,QR.ָ!E6禺Lytj`Mzay3g}w}5%;(ЊG|$͕`axNDEhEkq*o:IWj25QjN D׽FQ +RrP9r~Hm^eVȟY:G%h98,U49yԲMRUoFG݃ }q#A|6{S5qe(E~;2V3D|X./3Xz u2!վZ_:Z5 :BLH@ea`O%oZj5 0e?2Lbyx 0A\Oh Lil rɣΩz77SC:cүȒ"J%nD-pn)Lbʹ\d~z@INݾVO~+seZ䔢QbTؤ%T8񋆚}פ5J;CM6H-bKOL5'83jARwB.+3Գk=pz>lNb67(q=߀:n>gqO1&0]Ӄ+a$H@-;8H$Iz@,"~Рho CE N,ej*0VbƧ(O7@mlA̚u9Q +s+܊%#r2sh.EدGuj[->%ВX(f0UAnZ.DV8w Yc$/R㌔(D*fy&)tu˜_1IkT=Z' ũd-jnkV!l)4?5*zS̋PZ0tv`*ԆQv/qh3obѦ*vﵿOE< :еImE ֈ<թD=f8eZQYnEʩ:愆ɘ6AN UaDHi[o_,L2-9>8ٞu x_fE/~#Z:7izM n»{`_)dc%R%Q£7 %^#[C,evBF4q,0R\x"w4V+~r ُߋ(Ӏ кң&hϘH¶Kecf:nړMS"=g0yOS~ S$S"<koU_ x_5Ԍ1m\"__TVB]ÔϵD|Fwc2ײWe<4Zt؇J5fd֦g\G|aMp^5ʓs[B_sbqmҨh.fnh~!ei1)"tLǔ {780G)ֿ$'{γ˱"P9q ZKq(=`'fQ_Uh4Aʼn@6#s9ŭ'e58tIڿ}^azC*YįPs-[%j!b&kBIIs%{6^6'6izc z-u]ԮBZp` ?e:&Z|iĻCM8ʧM/\KK|%􍬙΋=82Qbf㤱#2N{;fEΉiIu8Zc\Ii1>ΖƝ0RYՍԶeR:-emr8-w'DVxpw\(eEmv0^mA͙hQ;h[;>lq>Ŕ2raz\"rk.[iZbC&bktzRB$]j#i2Zw?.}2>ь?ond \ݶI(6a{mt6CȥLBH-1Li)* 6#Mp(s³/rFvZ"H_}<.Ur]׵yy94!~y]I4pz:ŕ'DDFIJaJv1D+hsMRa\psZ|FS9QBy4BUbaBw睴Z>-qK4&/;QBJI-FQ+,:SX:5` f6Cr-8ٜ&^Sي7VRdA0X,}4L`K*95(Sk n+7 Io.Q!ꪣx'p^J Yi$ N_%^uBtl惌E,Ѧtzi)Ţj`ky 4ƁmlHzI\oME6Jhzv+}Sﵙ8=o1ekQꎂ,6.tbmzz'wi5JZ;$P"\jo]uyG4Y dFSLO:S{$pž5V]s=IjFs7)b YN^#yr3ۈJdG\(|'9_j4EwLXxd1"X_Fp=4X4x:s-)5{os*'P/iQŞr3COU@{M5kYl(ib"4d af:z)ىb1mEp`,+Ѿj]< >Aꗣ3ط`u/+tOx:A (cыxva0(=rmFT w (c}m =S7P~h/p&PX~;I!Ʒ/פbtl$fZq[޻*[+9> 6Kt?l؈1gc=7^ZT= {ޕŖg {Fj)f1}XhU,fNIO*+KzB, _Jod.^I-Q=,J]1)> ''ci\҈{leY_^" burXg~ '_dNsI\0']@{Qo hmQ2[`Fv>匋ұ\ed9#Cӝ_bceemz9oI=ћ?Udc{R=Σ4̝:Š5nb>K|oO+gIçh6)$ w sE[}CMXE_wz GP m4ч ,qzuFq=r&mKl«cbwM71cFz2~;pV'8}{a%ZBuzXg5ʞ29ezryO:M-tW{/LQ{ST%|LH_jqބE~/4˓y3^xV`ŦGy@.mIY;ѣKS)Kf։ L$"'55ÓK#lwyt#O&RfoG(7egIm+s )SSkzC&M-"Z Wsجp[eL\~.k%N)U(7SY6mW~^&.󝞝XIpޒݧ]"6x:X%ϻ~V'/:dQh4C ;nL ,PcmqZ)OD,1ީ߆ abj_MGe.egk"fͿ8Dݠ zZNjz]{#wuǁKwTZhc&'K\Gn0%0czu Iv>?B:HyZzqIZN1$?ƻ5[~o?,\iB_V>wcy /^b<#O11E=x5^:Q͍vz٧#ܣB_o6sy#Ea9=_|~k4Wi^C"bZ=owiE{z9ӯA녴ocg,쮧l I>B}+2g$=HRA{f՟ꥑBVue8g0ش\>g0OHj]ڶ6 M]Y]0ܽArRl5nePP{jO %'IJ4}h )XE|'EѼ<$'/;s10S7M./[NLFgo` 1YY=g |rgA#յk-!c)m#.4:_rH]zs| ,qn%MvU.  ï97-1SU`vAD-5TƪG~Mc{d'E#"~Z'GPFLڒَE"a|{Nh.5RUg Jo0W4F#&SH)rzNND^sL2DIJŗ}eTѶsbJ*H%r2 Xi pnMҋw㊹KoӯbrQX5B b ڐuY,|ӕ{roy?Iǧbo֫QC$ayQO͕S谞a?E-'O {jKo=E,r{4i<˧i/ΖzpBuF4QY~IrdüYS:oжnۘQs<9Q_+Xm)g(qA"d3}yVf=?FQ~M;X-reArWMNHMޓ\>1"7BqO|;1B/KhezE;*wU=m(:Xڤ1[hENHtT |Ի\)m-GTjܢؽ~4j6AZOT"B~5uMSqyv Nϙ5=W_n9Ь[tg~4 I>} u~1FU-U8b',è=+zY,G]/{-m'|Ylc H.Y{Us}˳Mε"mQ2쏭{2Fw]=7$Pdv#FPE~U-<>j)IAEwy))e\N /aIL< W܏\W^ ZKL.ےu #gcs&Y37ӫzTNߗu7)F.t~t ϊy>`DˮtdF")wa,A#$ u&jR5_#3bssM^zE>߰1}q?r'd}>r`d>HaxE7`I˾vW] WQ/=gvk\@yI4(` ,Q|q i_,%iԧT3旡};#'!`82f&\}I[kh6x{> |FbC (}=:ǻ'γ91CpnG\W;83+VhjhvDk;.7?y}v}w.Ob﵌E٢f垰-*_-lw_5m7?wߙX2hɞmg9~]r-bu!7,E]Uˍ )(8cV'>DKsa7X9OΊuCܢ _u#2TGVƚ4iMH [ibN3*NMQ.*cƏ ;gV'92<4.>pnN4-sƷQO@!ѥLÒB rZ ىMx?63Z*6\gԆU3 q/ˀ;mLqW7a!0EK9Bh-Kvakbu"ߋ*fo`< ?ʃ74e6h ͹We\ Ӣm#S׬XऺYĄ'xdq{vYw85<{#$)jܽ@>B3Kyo-'=߲Ϸ=I{_#-v6ы," w*jє/N#S$zzϨcSܳűc_גmx9^ػvwܝm0?>9KK+1WX雷:=k@Gc$SOB[|#GM %q,G*4k7&]t;-<ҺVao}"i5=gkhgsiW̠}Zy,mGg[*,<<>l&=yk4&s>0*o<3VLyȜoݹh`#cUhtE[*~iU")QsCgq{-#a]7 4@ޣ,m5$$=!M]>^3q]g̵m@A@ڕ_ս%$OsOS4‘)ZO:}WrLmǏCS7yWMj;)> H-+`9ް:myngqv<75떢6eh W>_Ƕ ki)m1gS|T%7rQ/qzv, 6&&r6&--6WMcwR Cv:@pՄkҿ]Y*/Hs*٬3GENkM8?[GK5%K/9V߆G+B?[H3Q&?&nLҥh9C 3 {|}JK1!U&+\-ęNgg腹:WV Ɯ"O>:K:.T?ӈa1M6/[S&k4$4SqՌXseDmqtc +F@6T+~iKS6FK.kYs9׽wЧC֮%}'?Ȓ,9e)6a" ty`DX!hv W}cMox/p]F-s0xc:}JE'yݚQ$_ Ix⦰WVq=nߚ PyD%״zZs,CP]YY,X>T0Rڗmk)*}ZAt>1 +w+XntZQw{zHLbzsz5Σ|б簌Ugy"By2NWTq/}y8Gl=_-{ rq(>c=7Ҡ;:c۝C> D~~Ads.;AYչ3+~۷ݕ_ڼԔugQW1 Wݽ=&+8d%\a)[c^q<uIYc8Ůr=uŞ*ftcyĒ%=ll%}6Ռ*$؄ygqXםnA76{O!-̄4;a^2nV2euǭYlUN{Xyk CLB֩--q-mxW K4i׬?cnLQeMÊPt}W}mM\lBVs~(*Zl2tԌ'X%Q+W6G;Xo#ʁߚVtյit"S/ʘS6ii?LuC(V>]{721\WbNL,G~gú:T]TVѾ +\Z~t"PLYAjƳWzJhmH+#23'O-cے'u4і{MY j`6XB.h< vSPО<\)o6kJwuvU&j:(MЉ-ah7-GDk.awѯ)k4Ŕmmw--e3lMhmrzNzb1G3S%GZT⸳Zc)G"[dב -u 3>G[6w-O6#ˣȼ%qb[b}θzhʁْxü G rZksPJ>JNMD kSI:[*V= |Ž\gr&@G^ {UrS_Zf׊n<5xO"f {xޚipΙGw6;H6]R.bK[\khBG۫&ڰɋvx;Щ1rI-\^-,d] WX9qƊU\${z{:ŋzCȀCRYVLE00Rzs:܎بrN8eA~, nh7cMry0bnke|󨩸\]v?b>_gs妥 x]jbܢ]#=cȬáR0ZǦXuw!Tv{ί"⊵)ZȊ&tMf#@(9W<G $dLHi[ilуǑֲ1U``ͭ 2exlUz<,)`? pɈmd ji#8m;c3߰y؉ }^z/Bix\Т:A ♗xV9y00\w}`sQZ,` wVC3=Qzۚ#KfNX$%k7{&,S#SOT\ƾ,|w,E핝97+V;hDf1Jz:mt߿aV9_,Tz<^J^{U*T횘RJWM[&uG{̮}7sL#AGV_LغG+Xg ߨ4g {/vН[uy`Ŕ0aMAUz\hH0ez[C?]Ԇ$sܙ)յ0c|ocď>P2Whk׽ Y~Fރ=->t=>9ʹO{Gͱ^E(-Ykx[1Ŭϐ ,4whfSpc;$/Lх;gY(׆>;5-)g 8*{ґgd= zTڥnηqFb7\~]_qu9'<#Z3)#u5;%}:$Ma㷰ލ;)\IX_lGj>y3n;8zߵO bV~`% /&v__&MsrU*P[r}U?ԳZ0e*7=K)::tgtS>{ݕd{67aH|_C>toZw,t|8L!Wߒos-\+tTyu x1t_gǤ &FVcC~$[9Lh leпϱzʘoo2:]avP gVExJ / د"fB}"-j\\}Kē}/Sb8ӧd?@xeS,GԁtTִ# zV#sD*s^pDY3B:Bgg&Ѡ9ڈsգV8SS˒v1wŠ1s !!9!Y Xˈ~e}҉ơ'ڮb%^I}61S8Ȳ޷7OSav.T`DdWX "@"&vW|U~_z)+ vf'Sx17{32k״}6Ҕ7f拉u=U[0K~숿'yٍMKq[+3hqџC{w5tj^NYjTEa3b%_9~{q\쿽ÿ/M5&~U.>I~y0ao'0/FY6162IkE3w= ?w B*{OqQƒ4!{V4Eɣ8狗T~.e kKfcvXK{^J*FAkHI 2="~8j *<Y8" [x  Y"Da48ׄ*Br@%GB/mٛ%BJԳ;Lؿ7!E+DLa~.BB. ;20 )XFc&D,ұu(FVkS% Ow%TKvQ„zr9Fr8߱+2%QdNL"s<HUmZ~۵58,3r \Z|Vx4!\{D=<)23[f] +3Zk}PIZYI8Kw&ڦ빧loGq| d!ǕG`\?ܔ9dhPGj$C2R|a̞Z}^y_#u}vo~ivK}R6YZv.UA񫫖a^{5ēSH`Hyg3+e)*!5ZSz]Ex3'FYǁ28S#ͧYx6!ИǝU]{mZMb>w>) ))cJ5x}}iW2,D!I)xr bjpyx !UәDۉ+7elMƚ8rn> j> 2q(vp֯ 9mj7)֫Û"!1xJOxC -6Ql'YlIl=I#5.LY!0DvA6}C-JR(- OH}/RYTemh#qj^, :UOqGJlׯ>^y2_?Oǎm5VSae_&lԷ)B~yG׬3B^"ƔMX&3yk&武A쳷!Sv 2jP;wdؓ[|[P hH̒~h5|J_^(7dUj)CU46џbژ :wC[,,z, L\eb5R[=.˩Zq?;4 DADUtī>ˆc%ƱߨO3ryجC1,eNUUjh {R}T':]qǚ:p»).'̀ߘ0L/a]㪧+X39e.kgvҍ3S s[$k}ԹUUe^: ; dCSDgHLg? d9Gup5qsd%#LT?F~Hz4EWס۲?Іm%MۓPR_^*4myTTYwg߭q!{zO`>tʄ2 |vɄz9bܸ)錾hW̔!6'?|{o?m_$%~Ӕa+m 4hќ^UxgI SƜUZF#т]Ҥ;+YX#~߯+-9|և0UH䂘0rNM̡$3SǑ_xDŽuN~h;nĦ[ }߄2NAcNԄũl:F]7 r>ƒg? 2w?;I58;ޱuM+Yᑔi2QT3ioE?fk'ҷ>N^'hsqZnz?0zu&ϴa{._ouwFη <ڃn=o?K GGN6ᄜ1ɪ9A}P>7tQmY;kZsþGH;Suĭ]vv z}̈́xa'<}d9BgҶ;Ϸ&v v.=/۫UQ;z-}F;\W{Ct!y4;Ï;r2tHG\= no}998 bj9QmjZ)|?v&@>*M+?ߦ"b5IX(axDwG`.^1z{IڳwLud%+T_HOs[lO# D$M2V8wO2%;28&摉-+)?+O"I;/<;VDՠ ؆>)&#?X6e+-ig-@[֯+Z9#Gww&o ]rk+BiMߥwV` 0$I1Zh6i#4&iYcZk"-r#KȖ͐rдoD? +͢\*2 %/ݞ%UfsϤ7`m$&Vjު/W 1*6tʔW5fHIm1U(qsɯj#V%iw ,F ytHm14jչ&>zͧJvn)ݰ&4E͂[k#83T;)a|3Iٷ qؘ!W~h)>"?m£eϢ?g&.*YUMhݲWUC"Zxr<w5aΗ:) ~nwe ,@ R֔ U-97Z%^(,mOVFNUUJ+, c{Tpb p.&aIVMk!Y6 X„]BMnqѹRV(PDo< I 6)N#{byC t2#{ ^_mwz?7Wc>mb͙>>v7Mn[o_۟r^һh$M&Am=E#uO?V= s@-X[~d3o=5K$cjyGqDrsY. i?x|6Cy|ƶ)kcގ[u26U]Z)P]C]zwWȟRЋx|^\^q<#tEp}]yxUE>dWC !+q#B@@e%(ӧYdB@Dc@\PqdqQ]D\ܛ;u{uWuWW/μZW$oubW˘e+S@n-:_1%\g3x5v%c |u/dZZMVϹ%lya-pڸU[^qX{m&wXw7; "W2αuZ7vpK'4rچNcq(sNJ 89M>Ԏp'iaˊOK79|tOOffRRa 06{d*saoxbO<$M ?O 76qほCɕԪJ- WhX6T?^7N{.3!/)^ܺT|{L'.ܞxzDn2)f/:Y2ɆP^2@rihH[Q(KVaN1iUj9 gԜ%!9LN)ocZ%NխTj|VAq]NUrnԫH s [ns'QtJضޒr]~Чb#p|JW8rq;洊SBiÝI63z[Q(kt 5&*uӘ>28tYwH7^8,i ںϿNcur8$]pDͤwy4cљ̷'cL[&Z.|/j!9˔Yiϻ‰,駄-nVL~(ee&חșخpJHJ笒-L>ډWorxRo4)=sn_o^.[ʝ#DueMK,bRPXWN Nѝ#;`9>\ޖpp޲l*kspn(Ujէ$?N39ɡf|z`4\7; G ]L1 .[_tw>8ɘeVyR,O^ML͖u:&]tAS #xUY$g~=v2Vbpăsv-]“n̳ˣeM?~]#(r&U4X#30q!:N1Mb7LfxRLM5QFh,pg( &q3"I"9v4 B5 _{P yZV:ɅszCkDv_(ƈ޲Z1J;L7'Rom]r-/ůM5HM6dB|)eManR'PzdaWߤ[X -&;GF:0kYY 74"Rh \}M/ѐyFlT<>~({)=wrPzOڈS& P"1ߗ3:Lw!btt>G^@V)#F6+GĿ堙Z}-.EKemy"]W?>A KwqCGh(1N-JU:\k"qMqZFqb' śh7eWPX%%OO\oOl[J?銧wtdX$R)nce7ſ*NeBoF)D;vZZ~U!֮F 'Zlx",i" 4)Lh{m| !f;3q}Hib ެ@+ |!=-GjƗ [\ wҙgb<:]\֕(r#~ws~m̅cgmE>f6"pɗ⽍N|wA3۹r<#YHo`Nd]/UHBDhUJF^hXG jGD6ƖGX 1 -nVՑ>d~\ jVķhmȟՓ|wa wsQRkϢl&$[ytXp% Pv'Uz<6=ܿ`d.=_c.wE; #y9%lqÝ/1hC^c/x=ݍ((кcxN0kL ~kޘUsxxwluDgn95[҅p1q8/uiۂ>z-~[]OL Bh ǡM:#o;1^ ~q?ļ.=Peh%eedW}VW[J .dI$5n/@)79E*W/j_3"ĝZFwKҀiIJhK_s(] t Z PnP&RPKJ+NN&w2̓m\YvԀ-QK`nf625 jm] "QYRGD '*EGM) =R =YW"ѳk+; =XU4Lt 3Ȱ3\bt Q|S`d4Sf"޲NcRir6Er,x\'ew)?{;yH*dڨ,uV9꣮U7jQKTZ֪ p/Wv@R:N{;ǫ5{)^:z\ z7zo7+z^W=m^^vxy}7AW{ijmQY";;PMjCTR]cT?០)5Ok5J+j#:5׵t-Juu]jJ7әEI_/lQwu'MugK]u7ݍzh8Z=toݛz>y:uAW_<}z#Vңh =AO@0耆)z зb;i4)o`uo-`oUXiܾ)`𽈭">/Vg8+o\|$fsRE/-F= P"c9[؄) *:0Lm}ekƻpr_N.{6mgmGfxK_6o/x6'"m^"mM['Glz[pI?tW$/6rKo.c*̋^29򣲭?{3 饱E4&=͘.6frc5\Zd `6~ 5!Ode u!TcAHhq> $FH0)<} 9z$M=1p(6LSdXp!՜@nFS(QQa=P{<+gG H"Kk81],e^Hs7℔l,lsQN]!7ȗ_ȃYK#4磦^bg̿0?0fWG|14_8 ;}'31O}^eu kjVCfLL=O4dLL4^5҄Ԯ2~]wI\͘0y썧7Zo@B9xP}CG&}7'`&2fRgNLNLe̴x%}w}+b0L|7s܃C*=Te1P=ς{Cm2P=4`!s  0Дyf+4g^\WhBV_K1ǐCKR0p cHc!9c2ps m"r]N H*jCPp`P@V# ur>~Y_W}4xͿ/է}Jg >Oc¯=x#X|<|l 6pp$8 'tp&=8kȈq#2*9T3M S2MS3M42M43͹&ɴ0<<2EB41A0F5948AE4C87D97735B67F6A52>] /Filter/FlateDecode/Length 746>> stream x5YPVeAB4ܗ,Tl۴=[hJŊ,rADT@r)2--mv44PLԻfꢙnsq~sfΙ{1&HRڠ ++ǂ7UAt r- & F ʰ5)(LAIk?d?*-`@TS%1OP{(^T RtkQXT c۫Nj /~$82/8:D67~A {`w JE3t9Z -V8' NB[tB{t@tBgtAWtCw)Sqzt8g?8p.q-.%ar\+q50܈q nmqD.܍{0#q/F>܏ F!<2EB41A0F5948AE4C87D97735B67F6A52>] >> startxref 733541 %%EOF xref 0 0 trailer <<2EB41A0F5948AE4C87D97735B67F6A52>] /Prev 733541/XRefStm 732592>> startxref 740421 %%EOF